Table 2 Primers used in this study
Primer nameDNA sequence 5′–3′
paxA-p1CATGCGATTGAAGTGTCGAC
paxA-p2GGAAGTGATGCGTGTGACTC
paxA-p3CTTCTTCCTCTGTCGTGCTTTCG CTTGACGAACACGCGGTCTC
paxA-p4GTCCTCAAGACCCACTACGAGACTTGCCCATGATCAAATG
paxA-p5CCTCGCATATGCTGATGATAG
paxA-p6GCATCGGCGAGCACTGGTCT
paxA-FGATATACGGACGCAGTGAAC
paxA-RCCCAGTTTCGTTCCGAGGGT
acnA-p1CTTCTCCAGCGCTTGCCATAGC
acnA-p2CGTAGAACTGCGCAGTGTCGAT
acnA-p3CTATTATCTGACTTACCCGCCAAGTTGAGCGATATGCAGGTTC
acnA-p4CCAAGAGAAAGCGTCAAGTCAGCGTGTGATCCGTTCTTAATC
acnA-p5CTGTACGTAACGTAGGCGACG
acnA-p6ATCCTCCATCTCCTGGTCGAG
acnA-FAGAGGGTAGAAAATGCGGGA
acnA-RATACATGGCAAACTGGGAGG
paxB-p1ATGTCTGGACTGGCAACACC
paxB-p2GACGTGGCTGACAGTCAAAG
paxB-p3CTTCTTCCTCTGTCGTGCTTTCG CTTGATGGGCAATCGATATC
paxB-p4GTCCTCAAGACCCACTACGAGTGGCTTTGGTAGTAGGTG
paxB-p5GTCTCTCCCACAATTGTCTC
paxB-p6GTAGGAGGCTGAGATGCGAT
paxB-FAATCTTCCCCCACGAGCTAC
paxB-RGACGACTTCAGACGAATGCC
alc-paxA-FAGCAGCGGCCGCTGGCATCAGACATGGGCGACT
alc-paxA-RAACCTCTAGACACACGTCGTCGACATCGAG
alc-paxB-FAGCAGCGGCCGCTGATCCACCGGTCCCCTCTTC
alc-paxB-RAACCTCTAGACCTGGGAGAACTCTCCTCGC
gpd-acnA-FGGGCCGCCACTCCACCGGCGCCTTGACGGTTGACGAGTCGTG
gpd-acnA-RCTCGAGGTCGACGGTATCGATTCACACGCTGCCGTTGATAG
gpd-paxB-FCCTTTAATCAAGCTTATCGATATGATCCACCGGTCCCCTCTTCA
gpd-paxB-FCTCGAGGTCGACGGTATCGATTCAGGCCCTAGGAGACGACTT
RT-acnA-FAGAGGGTAGAAAATGCGGGA
RT-acnA-RATACATGGCAAACTGGGAGG
RT-paxB-FGGCATGTCGGTCACTTCTTCTGC
RT-paxB-RCGCCTACAGCAGTGATCACG
c-paxB-p1CACACTAGGTTCACAACGCAGG
c-paxB-p2GGTCACCAGACTTTGCAGCTAC
c-paxB-p3CTCTAGATGCATGCTCGAGCTCAGGCCCTAGGAGACGACTTC
c-paxB-p4CAGTGCCTCCTCTCAGACAGTTGTGGCTTTGGTAGTAGGTG
c-paxB-p5GGTTCAACTAACGTCTGGTTCAG
c-paxB-p6CACCACGATTGAATCAGGGATG
PyrG-FGCTCGAGCATGCATCTAGAG
PyrG-RCTGTCTGAGAGGAGGCACTG