Table 2 Primers used in this study
Primer nameSequence (5′–3′)
VMA2(−840)GAATCGGCTAGAGATTACAAGCTCA
VMA2-c4GATGTTCTTCGAGACCGGGTTGG
Rim8:451URAforTTC AAA GAT ATG GTA AAT GTG GAA AAG CTA AAG AGA CTG AGG AAT GTA ACT GGT TAC TGA GAG TGC ACC ACGCT
Rim8:end URArevATA GTC ATC ACA AGG GGG AGG ATC GCT TTC TAA CTG TTG TAG TCT TTT TTG TTC AAG CAG TTT TTT AGT TTG CTG GCC
P506A.ForTTTATCATTTGGCGAATACTTTGCAACTGGAACATCGTCACTATCATA
P506A.RevGTCAGTGTACCGTCGGAAGACAGACAAGAACTTGAACAAAAAAGAC
Rim8-F2TTAATTAACCCGGGGATCCGATAGTCATCACAAGGGGGAGGATC
Rim8-R1GTTTAAACGAGCTCGAATTCAAAGTGCAGGTAACAAGTCATATACTCG
Rim8 553GAAGCAAGATGCGAACGTGAG