Table 3 Oligonucleotides used for quantitative PCR
DescriptionOligo Sequence
ChIP primers
 ATS1ggtaacgcagccgtttgagc
 ATS1cctcatcgtgccccagtcc
 HMR-Egtaccctttttattgcatatag
 HMR-Egtttgcaaatgtggacgaaaag
 0.3 kb from Tel VI-Rctgagttcggatcactacacac
 0.3 kb from Tel VI-Rgatcattgaggatctataatcaac
 1.3 kb from Tel VI-Rgtaggaatgcgaaaggatctgtc
 1.3 kb from Tel VI-Rgtgctaaaggaatccccagagac
 1.7 kb from Tel VI-Rcaaattgcaggcaaataaacac
 1.7 kb from Tel VI-Rgcatgatgatccccaataac
 2.3 kb from Tel VI-Rgacggaaagagggcagaaag
 2.3 kb from Tel VI-Rcagcgcacgtttgtttgatg
 3.3 kb from Tel VI-Rgagttttgtagtagcgatccgac
 3.3 kb from Tel VI-Rgtagtgtaaccataagaaatccag
cDNA primers
 NTG1caaggttcctcgatttagtg
 NTG1gactccagatcagacaagaac
 YFR057Wcaatagcctttcaaagcatac
 YFR057Wgctttgttacgcttgcacttg
 HMR-a1atggaaagtaatttgactaaagtag
 HMR-a1ccaaactcttacttgaagtggag