Table 1 Summary of genome editing experiments
StrainsgRNA targeting sequenceHomology arm lengths in bp (5′/3′)Distance (bp) of cut from site from exogenous DNA insertionNo. of P0s successfully injectedNo. of insertionsInsertion frequency per P0 (%)Modification
klp-12 disruptionGATCCACAAGTTACAATTGG1514/1517120315Disruption
mec-8 deletionAAGAGTGGAGCACGCAGAGG1514/1536726116Deletion
his-72::GFPAAAAGTGGTGATGAGATCGG1574/65011220210C-term. Tag
his-72::GFPAATTCAATTCAAAACTGCGG1574/65026920525C-term. Tag
his-72::mCherryAATTCAATTCAAAACTGCGG1574/6502692015C-term. Tag
his-72::3xHAAATTCAATTCAAAACTGCGG1574/65026915320C-term. Tag
3xHA::lsd-1ACATGGCTTCTGGGACTCGG803/8511620420N-term. Tag
GFP::3xHA::lsd-1ACATGGCTTCTGGGACTCGG801/8511320210N-term. Tag
him-18::3xHAAAGACGGGAAGAGCACGTGG1027/9672220420C-term. Tag
  • Table includes information on protospacer sequences used for sgRNA construction, length of 5′ and 3′ homology arms in repair template vectors, distance of double-strand break sites from nonhomologous sequence inserted during editing, number of P0 adults successfully injected, number of independent insertions obtained, and efficiency of editing reported as a percentage of a P0 animals injected.