Table 3 Primers used in this study
Primer namePrimer sequenceImbedded RE
1GAD·Fob1·5′5′-ATGCTA GGATCCAC4ACGAAACCGCGTTACAATG22BamHI
2GAD·Fob1·3′5′-ATGCTA GTCGAC1701TTACAATTCCATTGATGTG1683SalI
3Fob1·Dom2·3′5′-ATGCTA AGATCT A 1258CATTAGCAAGGGCAAAAG1241BglII
4Fob1·Dom3·5′5′-ATGCTA GGATCC1259AAGCGGATAATAGCTGTAAC1278BamHI
5Fob1·N-term·3′5′-ACGT GTCGAC849AATTGGAACCCTAGCAAATG829SalI
6Fob1·C-term·5′5′-ACGT GGATCC850ACTTCGTAACATCAAGCATCTTA G868BamHI
7E420V 3′5′-ACGTACGTG1291GAATTC CATTATTGTTACAGCTATTATCCGCAACgTTAGCAAGGG1247EcoRI/AclI
  • The underlined sequences reflect restriction sites imbedded for cloning purposes. The nucleotide in bold in primer 7 was mutated to create the E420V mutation, which also created the new AclI restriction site. The superscript numbers within the primer sequences define where in the FOB1 DNA sequence the primers reside.

  • RE, restriction enzyme.