Table 3  PCR-based markers for determining genotypes of identified mutations
Product size (bp)
MutantPrimer namesPrimer sequencesEnzymeWtMutant
pfl7/ped1-7PED1-7GAAATTCCAGCCAAGTAAGTGATGDpnII125100, 25
PED1–DpnIIaCGTAGCTTTGTAAGTAATTATTACCGA
pfl20/lon2-6LON2-14AATTTGTTCGCTTATCTTTGGGTGGTGTMlnI57, 4299
LON2-15CTCCCCAAGTTCCTCATCAGCATAAGC
pfl47/pex6-2PEX6-19AGGAACCTTTGATCTATACACCAGTAvaII62, 2991
PEX6–AvaIIaAGTGAATCACTCCCAAACCGCCCTGGTC
pfl49/pex14-6PED2-1CATCCTCATCATCTCTCATCATAvaII150, 30180
PED2–AvaIIaGAAATAATGATTAGAAGGTGTAAATTGGAC
pfl164/175/ pex14-5PED2-2CATCCTCATCATCTCTCATCATRsaI156, 25181
PED2–RsaIGACTGGGAGGTAATTTTGTATG
  • a This is a dCAPS oligonucleotide (Michaels and Amasino 1998; Neff et al. 1998); the underlined nucleotide differs from wild-type sequence to create a restriction site in either the mutant or wild-type PCR amplicon.