Table 1 Detailed summary of MenExi alleles
ExcisionDeletion size (bp)Insertion5' deletion from TSS3' deletion from TSSMenExi/MenEx3+ activity
MenEx81,651TCATCATCATAACATAAAG−13473040.7249 ± 0.0397
MenEx94,080NA−220318770.6876 ± 0.0313
MenEx122,500TTAATA−16358650.7422 ± 0.0397
MenEx152,414NA−23061080.7560 ± 0.0364
MenEx30NANot sequencedNANA0.7922 ± 0.0374
MenEx432,682NA−20446380.6639 ± 0.0352
MenEx483,581NA−201415670.7553 ± 0.0345
MenEx523,058TAAACAGACATT−162314350.6619 ± 0.0361
MenEx5516,231NA−1024559860.5414 ± 0.0356
MenEx571,379GATATATAG−1304750.7454 ± 0.0462
MenEx58535AACAATTCGCAGAGTCCT−2153200.8400 ± 0.0401
MenEx60646CATGATGAAATAATAAATAATAATA−2134331.0569 ± 0.0490
MenEx76669CATGATGAAATAACATAA−2154540.9097 ± 0.0443
MenEx772,070TAAATAA−14046660.7648 ± 0.0440
MenEx812,765NA−175910060.6670 ± 0.0300
MenEx862,239NA−2147920.7665 ± 0.0391
MenEx1093,551NA−26359160.7523 ± 0.0521
MenEx1191,379GATATATAG−1304750.7663 ± 0.0451
MenEx1252,378GTT−15138650.7032 ± 0.0317
  • MenExi lines are partitioned into overlapping groups by a Tukey’s HSD test of differences in transvection-influenced enzyme activity. MenExi alleles that do not share a letter code are significantly different.