TABLE 1

PCR primers and their sequences used in this study

Primer IDPrimer sequence
P1-2415fCGCCGAACTTTCACTGCTCTGCTA
9D9A5537fCGCCACCTGATGATCGAAGC
P1-2915rGACAGTTCGCAGTTGGGTTGGG
P1-7061rGGTTTGTTTGTGCTGCCTCC
P1-15588fGCTATCAAACAGGACACGGGAGAGAAT
PP1′GACCGTGACCTGTCCGCTC
P1-7869fATTCAACCAATAACTTTACGACTGTTCTCTTCTCA
P1-12046rGATGATGTCTTCTTCCTCCTTGG
9D9A33680rGCCCTTATTTCAGCCGTATTCAA
Ac4436fGATTACCGTATTTATCCCGTTCGTTTTC
Ac120rCCCGTTTCCGTTCCGTTTTCGT
Ac2680fTGCCATCTTCCACTCCTCGGCTTTAG
PA-A11GCGACGCCAAATCATCGATAG