TABLE 3

List of oligos

NameSequenceDescription
GCN5AAsGACTATGTTAGAAATGCCGCGAACATAAAATATTTTTTGGCN5 T203A/S204A, sense
GCN5AAasCAAAAAATATTTTATGTTCGCGGCATTTCTAACATAGTCGCN5 T203A/S204A, antisense
GCN5T203AsCTTAAAAGACTATGTTCGAAATGCCTCGAACATAAAATATTGCN5 T203A, sense
GCN5T203AasAATATTTTATGTTCGAGGCATTTCGAACATAGTCTTTTAAGGCN5 T203A, antisense
GCN5S204AsCTTAAAAGACTATGTTCGAAATACCGCGAACATAAAATATTTGCN5 S203A, sense
GCN5S204AasAAATATTTTATGTTCGCGGTATTTCGAACATAGTCTTTTAAGGCN5 S203A, antisense
T211AsCATAAAATATTTTTTGGCGTACGCAGATAATTACGCTGCN5 T211A, sense
T211AasAGCGTAATTATCTGCGTACGCCAAAAAATATTTTATGGCN5 T211A, antisense
T211/Y212AsCATAAAATATTTTTTGGCCGCGGCAGATAATTACGCTGCN5 T211A/Y212A, sense
T211/Y212AasAGCGTAATTATCTGCCGCGGCCAAAAAATATTT TAT GGCN5 T211A/Y212A, antisense
Y212AsCATAAAATATTTTTTGACTGCAGCAGATAATTACGCTGCN5 Y212A, sense
Y212AasAGCGTAATTATCTGCTGCAGTCAAAAAATATTTTATGGCN5 Y212A, antisense
spt3KXGATCGGCGGAAACGAAAAGTAAAAAGTAAGGTTGAAGACACReplacing SPT3 with KanMX
TCTGGCTTCGTACGCTGCAGGTCG
spt3KXasCATACCAGAAGGAAACCCATGCACCTCCATGATGAAATTATA CCATAGGCCACTAGTGGATCTGReplacing SPT3 with KanMX
MHK232GCGATTTCGAAATCGTTCGenomic PCR to verify gcn5 mutant integration
MHK234CTGAGAGAATAGGAGGGenomic PCR to verify gcn5 mutant integration
MK80CTGTGGGAAAAACTTATCHIS3 oligo for ChIP, −1 nucleosome
MK80asAAAGGACTGTGTTATGACHIS3 oligo for ChIP, −1 nucleosome
MK81TGAGCAGGCAAGATAAACHIS3 oligo for ChIP, +1 nucleosome
MK81asCCACCCTTTAAAGAGATCHIS3 oligo for ChIP, +1 nucleosome
MK100-1CGGTAACATCGTTATGTCCGACT1 oligo for ChIP
MK100asACGATAGATGGACCACTTTCGACT1 oligo fpr ChIP
YLK92CTGCTCAGTGCGGCCGCTCTAGCTCTAGAATGATGGACAAG CATAAG3xHA–Spt3 construction
YLK93TGCAGGTCGACGGTATCGGGGGATCCACTATTACATGATAAT TGGTTTAG3xHA–Spt3 construction
YLK94TCCGAATTCGGCGGCCGCATCTTTTACCCATACHA–Spt3 PCR from pYL89
YLK95CTACTCGAGCTACATGATAATTGGTTTAGAACTGAGHA–Spt3 PCR from pYL89
YLK107GTACAATCAATCAATCAATCATCACATAAAATGTTCAGCGAATTG ACCATGGCAATTCCCReplacing Gcn5–TAP with HA-
Spt3–TAP in pYL54
YLK108GACGGCTATGAAATTCTTTTTCCATCTTCTCTTTTCCATGGATGG TTTAGAACTGAGTCReplacing Gcn5–TAP with HA-
Spt3–TAP in pYL54
HIS3 5′RTAGCTTTGCAGAGGCTAGCAGHIS3 RT–PCR 5′ primer
HIS3 3′RTGCGAGGTGGCTTCTCTTATGHIS3 RT–PCR 3′ primer
PGK1 5′RTTCATTGGTGGTGGTGACACTPGK1 RT–PCR 5′ primer
PGK1 3′RTGCAACACCTGGCAATTCPGA1 RT-PCR 3′ primer
o415GCGAGTGGCACTGGAAATCCTTAAGGGTAGAGGTGGTGAAGATG ATTTGAAAAAAGCSPT3(1–107) sense
o416GCTTTTTTCAAATCATCTTCACCACCTCTACCCTTAAGGATTTCCA GTGCCACTCGCSPT3(1–107) anti-sense
o419GGCCGCTCTAGCTCTAGAATGATGGACAAGCTTCCTGGGGCAGG TGGTGAAGATGATTTGSPT3(107–337) sense
o420CAAATCATCTTCACCACCTGCCCCAGGAAGCTTGTCCATCATTCTA GAGCTAGAGCGGCCSPT3(107–337) anti-sense
o421GCCGCTCTAGCTCTAGAATGATGGACAAGCTTAATAATGACGACAAT GATGATATGGATGSPT3(156–337) sense
o422CATCCATATCATCATTGTCGTCATTATTAAGCTTGTCCATCATTCTA GAGCTAGAGCGGCSPT3(156–337) anti-sense