TABLE 1

Primers used for RT–PCR analysis

TranscriptForwardReverse
Act5C5′ GTATCCTCACCCTGAAGTAC 3′5′ CATGATGGAGTTGTAGGTGG 3′
aret-RB5′ AGTTCGGTCTCGCGGAGGTG 3′5′ GAAATAGCTAGGCAACTCGG 3′
cg159305′ CAATGAAGATGCATGAACTGC 3′5′ GAAATAGCTAGGCAACTCGG 3′
esg5′ CGCCCATGAGATCTGAAATC 3′5′ GGTCTTGTCACAATCCTTGC 3′
gskt5′ CATAAAGAAGGTCCTGCAGG 3′5′ CAGCAACTCTGACATCACAC 3′
Wnt25′ GCGGCACTGCGTGGTCCTTCG 3′5′ GTGAGGCTGCCTACACCTATGCG 3′