TABLE 3

Genetic markers

Marker nameTypePrimersaCoordinatesb
DBarX1112 (Rbm10)GTCCTGAAAGGCCCGTGT20212996–20214673
GAACCAAAGGCCAAAACTGA
DBarX 511GGAGGCTTAGCTTACCCCTTT40781605–40782207
ACGTGAAATTGTGTGCGTGT
DBarX 521CACATGAGCTCTGTTGCATCT53759564–53760159
AAAGTCACCCTCATGGGAAG
DBarX 1122 (Bgn)GACCACAACAAAATCCAGGCa70738334–70738684
CTCTCACCTGGAGGAGCTTGa
DBarX 1132 (Tbl1x)GGACGCTCACACAGGAGAAGa74895226–74895824
GTCCTTGGAAGGTTTTGACTGa
DBarX 1142 (CNS)CCAGCTTTGGTCATTTGACAGa84947982–84948629
AGGGACTTGGAAAGCTCACAa
DBarX 531AAGGCAATGGCTTCATTGTT129415830–12941667
TGCTTCTGACCTTTGAGCAG
DBarX 541CCACCTCTGTGAGCACATTC131291877–131292275
TGTCTAAATGTGTTTCTCACACTCC
DBarX 551ATGCACCCCTCCAGTTCTGC136812895–136813493
TGGATCTGCAGTAATGTGCAGT
DBarX 561GAGCGTCCCGGGAGCTCCTT147389767–147390410
CCACCTCTTACAGGAAGCC
DBarX 115c2 (CNS)ATTGCCTGCCAAATCACACTa156649400–156649723
TGATTAAGTGACCCCAGAAATCa
DBarX 571TCCATTGTTATTCAAGGAAGGAA158286467–158286797
GCTTTTGTGCAGATTCCCAG
DBarX 119c2 (CNS)AGGTGATGTCAGCGGCTCTa158595286–158595666
TCTTTCCAGAACTCATCCCCa
DBarX 1162 (CNS)GTCGATTAGCATTGGCATTTa162665068–162665558
AAAGCATAGCACACACAAGGAa
DBarX 118c2 (Prps2)GCTCATTGGTCAGCCAATCT163801537–163803099
CCATGTGCTTTGTGATTCCA
DBarX 1172 (CNS)GAACAGCAAGGAGGAAATTGa164867514–164867994
CCTGAAGCCTCCCACTCCa
  • Marker names correspond to those in Figures 2 and 3; types “1” and “2” refer to SSLP and SNP markers, respectively, the latter followed either by the gene name or conserved noncoding sequence (CNS) depending on how the primers were derived. Oligonucleotide primers were originally designed from mouse genome sequence, but unless otherwise stated (see footnote a), new primers were generated from the amplified hamster sequence and used for subsequent genotyping.

  • a All of the type 1 (SSLP) primers represent hamster sequence. However, for seven of the nine type 2 (SNP) primers (those indicated with a superscript a), oligonucleotides based on the mouse sequence yielded robust products when amplifying hamster genomic DNA, and we did not redesign new hamster primers.

  • b Physical position of amplicons on the mouse X chromosome based on coordinates from the July 2007 (build 37) release.

  • c Not included in Figures 2 and 3 because they added no new map information. Genotypes from DXBar115 and DXBar119 were identical to those obtained with DXBar57; genotypes from DXBar118 were identical to those obtained with DXBar117.