TABLE 3

Summary data for the six H. contortus microsatellite markers on the X chromosome fragment

MarkerPosition on 408,911-bp contig (bp)Repeat sequencePrimer sequences (5′ → 3′)Sizes of alleles (bp) in MHco3(ISE) isolateHeaHobHoc
HcmsX142142,492–142,517TTTG TTTA (TTTG)3 TTTC TTF: ATTTCCAGGGCTACGTAGTCC178, 179, 1800.66300.6
R: AAGTTTCCACTGAGTCAGTGC
HcmsX146146,936–146,956(CTTT)5 CF: CAATTGTACGATGATCGCCTG147, 1510.47900.433
R: CAACTGTCACACACGCATAGC
HcmsX151151,062–151,089(GT)7 GCT GT GG (GT)3 GF: CAGATTGTCGTCTAGTGGCTG226, 2340.49900.467
R: GTCATCTTCTCTTCGTCGTCC
HcmsX182182,741–182,769TAAGAGG TATAAGG (TAAGAGG)2 TF: GACACTTCAAGCTGTTCAGTG372, 3740.48500.5
R: GCGATGGTGAGCAAATTGAGC
HcmsX256256,792– 256,824(TG)3 TC TG TA GG TG TA (TG)3 GG (TG)3 TF: TCACTCGTCACAAATCACACG239, 241, 2450.56900.467
R: GTCGTTGTAACTCGTTGACC
HcmsX337337,830–337,873TTTCA TTTCAC TTGCAT TTTCAT TCTTCATT TTTCTT TCTTCATF: GTTGGCATTTCCTGTCATACG332, 3400.47800.465
R: TTTAGTGTCAGCGCCTGTTTC
  • a Expected heterozygosity based on allele frequencies in total adult MHco3(ISE) population (56 male worms plus 30 female worms).

  • b Observed heterozygosity based on genotyping 56 MHco3(ISE) adult male worms.

  • c Observed heterozygosity based on genotyping 30 MHco3(ISE) adult female worms.