TABLE 1

Primer sequences for linkage mapping and H. melpomene BAC library probes

Mapping method in H. melpomene
PrimerSequenceAnnealing temp.Brood 44Brood 48Brood 52BAC screen resultAccession no.
AFLP markers
    ACC_CAG_FTTCTCAGCCCTAACAGTTTCA58LPANAFI109944
    ACC_CAG_RATTCACCGCCGCTAATACAA
    CC-CTA_F1TCCCGTCTTAGCGAGCAC68LPALPALPANonspecificFI109939
    CC-CTA_R1GTTCTCTACTTTCCGCCCATT
    CC-CTA_F2TATCTCGCGAAGCTCTCGTA60Contig 196FI109939
    CC-CTA_R2GGCAGAGGGAACCTTGTGT
    CG-ATG F1AATTCCGCCACTAAACAGGA58LPAContig 446FI109941
    CG-ATG R1GGTAGCTGACGCTGGTGACContig 936
    ACA-CAT F1TCGCCCGATGATAATATAA55LPANAFI109937
    ACA-CAT R1GACATCTACGTCACTATTCCC
    ACT-GTA F1TAAGGCTTATTTTTACTTGGC55LPALPAseqContig 1729FI109936
    ACT-GTA R1TCTGGTGTAGAGGCAATGT
    CT-CTC_F1GATGCTATTCGCTGAA55LPANAFI109935
    CT-CTC_R1ACTCCAGTGAATAATAAGTTT
MRSP
    MRSP_F1GAACACGCTGTGCTTTTCAA59BanIIStyIContig 16EU711404
    MRSP_R1AATGGTTGGCAGAACCAGAC
    MRSP_F2GGGTCGTTGAAGAGAACATGG60MseINAEU711403
    MRSP_R2TACGCCAGTCAATGAAGACG
BAC end primers
    bHM5K10_t7FAAACGACCTGGGGAATTTTT58LPALPALPANAFI107292
    bHM5K10_t7RCGTGTCACGTAGAGTCACGAA
    bHM40C14_sp6FTCCCATTCAAGCCTGTAGGT58NlaIIISspINlaIIIContig 1729FI107289
    bHM40C14_sp6RTGTGAAAGTTGGTCACGTTTG
    bHM7G5_sp6FAGTCTGTGGTTGGTGCCATTa58LPFLPFNAFI107293
    bHM7G5_sp6RGACCAGCGATTGACAAGACA
    bHM35J3_t7FTTGGTGTTACAAAGCGGTGA58LPALPANAFI107286
    bHM35J3_t7RACGAACGCTTCGTGCTCTAT
    bHM7G5_t7FAGCCGCAGGAAAAACCTAGTa58LPFLPFLPFNAFI107294
    bHM7G5_t7RATGCCATGCCTTTTTACCAG
    bHM40A21_sp6FGAGGCGTTGAGTGAGGAAACContig 936
    bHM40A21_sp6RTAACAAGGCGTTGAGTGCAG58Contig 1080FI107288
    bHM47N1_t7FTCGACGGCTAATGCATAAAAa58LPFLPFLPFNAFI107290
    bHM47N1_t7RAAGGCGACTTCGAATGACATA
    bHM5D10_sp6FGGTACCACTACTCGGGGAGA58LPFLPFLPFNAFI107291
    bHM5D10_sp6RACAGCGGCTAACGAAATGAT
    bHM36K2_sp6FGCTGTATTTCTATCTCGCACTGGContig 1080
    bHM36K2_sp6RGCACTCTTTCGAGGGTGGTA58AluIHaeIIIContig 1352FI107287
Contig1224
    bHM49H2_sp6FAGAGCGGCTTCGTTCAGAT58AluINAFI107283
    bHM49H2_sp6RAGGGACCCAAATCCGTACAT
    bHM28F19_sp6FGACGTCGCTTCGTACCAAAT58LPALPALPANAFI107284
    bHM28F19_sp6RCATGGCACTTCGGTTAGACA
    bHM7N20_sp6FGCGGCGTGCAAATTATACTCa58LPFseqseqNAFI107295
    bHM7N20_sp6RATCCATTCATTCTGGCTTCG
    bHM28L23_sp6FTGAGCAGATATTTTCGCGTTAContig 1080
    bHM28L23_sp6RACGAATTTAGCGTTGGCAAT58Contig 1352FI107285
Contig 1224
    bHM3O8_t7FTGCCAATTAAGGATGCCATT58Contig 446FI136219
    bHM3O8_t7RTTTCAACACTCTTGCCCTCA
  • LPA, length polymorphism identified using agarose gel electrophoresis; LPF, length polymorphism identified using fluorescently labeled PCR products resolved on an ABI3730 sequencer. Restriction endonucleases used for identification of polymorphic sites in PCR products are listed. Seq, polymorphism identified using direct sequencing. No polymorphism was detected in broods marked with a “—”.

  • a Primers fluorescently labeled.