TABLE 4

Oligonucleotides used for allele specific PCR

GenePCR allele-specific primersSNP positioncM
Chromosome I
cathbp[long tail]-GTGATCCGTAACCAGCGA3305
[short tail]-GTGATCCGTAACCAGTGT
ATCGGTCATGGCYGAAGC
CYP4C52[long tail]-TGTAGAGTTTGAACATCMCGTG31,58026
[short tail]-TGTAGAGTTTGAACATCMCATT
GCCGATCCTGGAACAAGA
CYP4G35[long tail]-AAGTTACGGTGGATATTCGGC59228
[short tail]-AAGTTACGGTGGATATTCAGT
CTCTCGCTCGTCCTCTGC
CYP6P12V2[long tail]-CTTCGGGTTGTTATAGCTC37532
[short tail]-CCTTCGGGTTGTTATAGTTT
ACGATTCTGGTGCGGGATTTTGC
CYP6P12V1[long tail]-AGCATCCGTAATCTTAACCCCCCAC76236
[short tail]-AGCATCCGTAATCTTAACCCCCTAT
GTTCATCTTTGCGTCGTTG
CYP9AE1[long tail]-ATTGGTTAGCGAAACGATGCTGCAA77742
[short tail]-ATTGGTTAGCGAAACGATGCTGTAC
AGTAACTGAATCAAATCTGG
ARC2[long tail]-CTTCTCTGGYTCATCTCCTAACATC−13,71848
[short tail]-CTTCTCTGGYTCATCTCCTAACGTG
CGTCTGAACAAAACCCCC
APN[long tail]-GCTGATTGATGACTCGATG2,06254
[short tail]-GCTGATTGATGACTCGTTC
GAATGAGTTTTAGAGTGATGTCGT
CYP6AL3[long tail]-GGTAYGGAAGACGATAGAAGAT76259
[short tail]-GGTAYGGAAGACGATAGAAAAC
GAAGTAATAGCTGCATCATATCYTT
CYP6BB2[long tail]-AGTTGAAATACGATACTGTG1,08566
[short tail]-AGTTGAAATACGATACTATA
TGARTGCCGATTTGATGG
Chromosome II
CCEbe2o[long tail]-ACGGATGATTAGCCAGGTAT93625
[short tail]-ACGGATGATTAGCCAGGCAA
TACAAYCCATTCTCACCGC
mucin[long tail]-GTTGAAGAGGGAGGAGCAATA62128
[short tail]-GTTGAAGAGGGAGGAGCAGTG
CACCACAACGGCACCAGC
CYP12F5[long tail]-GATTGTWAAGGTTGGTTTTCTTCAA62431
[short tail]-GATTGTWAAGGTTGGTTTTCTTTAT
GCTGGAATGATCTRAAGTT
CCEae2D[long tail]-TTCACRTTTTCCGTTCGTCAA10,86233
[short tail]-TTCACRTTTTCCGTTCGTTAG
AAAGCCACCCCAGAAGATA
GSTe7[long tail]-ACACGATACCGACCATGGA23137
[short tail]-ACACGATACCGACCATAGT
TACTTGGACACCAGATAG
chymo[long tail]-GTCGTTTGGTTGCGGARTTCAGCG38743
[short tail]-GTCGTTTGGTTGCGGARTTCAACA
CGGGACTGACTCCYCCTTGATAG
CYP9M8[long tail]-CGATTACGACATAGCTGCCACAGA9,87449
[short tail]-CGATTACGACATAGCTGCCACGGC
CATAAATAGTAAAGCAAAGTAGCG
CYP9J32[long tail]-ACTGCTTCCTTGATGATTGTG84752
[short tail]-ACTGCTTCCTTGATGATTATT
AAGTTTGATGATTAAGATGGG
Chromosome III
CYP6BY1[long tail]-GTTCCTAAAACCCCACTTCCCGGAC0
[short tail]-GTTCCTAAAACCCCACTTCCCGAAT
CGGTTCTTCATCTCCTCGTAG
CYP9J19[long tail]-GCGACTCCTCTCAGRGACAC1,2014
[short tail]-GCGACTCCTCTCAGRGATAT
ACCACCATATCCAGATACTT
CCEae1o[long tail]-ATCGTCTTACGCATTTTGA1,5077
[short tail]-ATCGTCTTACGCATTTCGT
TAGCAGAGGTGCCCGAATC
CCEunk7o[long tail]-GCAAGGTTTGAATTATGTAAGTCTA1,23624
[short tail]-GCAAGGTTTGAATTATGTAAGTTTT
GTCGGCAAATAACTGAAA
CYP4H32[long tail]-GCTGAACGGAATGTAATCGTAYCGG1,29927
[short tail]-GCTGAACGGAATGTAATCGTAYTGA
CTATCCAGATCCAGAACG
para[long tail]-ACAAATTGTTTCCCACCCGCACCGG96,98431
[short tail]-ACAAATTGTTTCCCACCCGCACTGA
TGATGAACCSGAATTGGACAAAAGC
malt[long tail]-ACCGTCCARATCCCCGATAGCG12333
[short tail]-ACCGTCCARATCCCCGATAACA
GAAAYTTCTACCAAGTTTACCCAA
vitgC[long tail]-TGCCAAATGTAGCAAACG−8638
[short tail]-TGCCAAATGTAGCAAGCA
TCCGCCATCACTTCTTCAGC
CYP4H30[long tail]-GGAGCGATTTTCCCAC19,41241
[short tail]-GGAGCGATTTTCCTAA
CGCTGACCAATACAGTTCCTC
UGALS[long tail]-TGGATGCCGAACTACCAG43346
[short tail]-TGGATGCCGAACTACTAA
GAGCGGTCATGGTCTTGGA
CYP9J29[long tail]-ATCGGGTCACGGTTTCCG1,52150
[short tail]-ATCGGGTCACGGTTTTCA
GAACGAAAATCTACGCAGCAT
CYP325R1[long tail]-TGATTCTTTGGTTAATTTTCACTTA37853
[short tail]-TGATTCTTTGGTTAATTTTCACCTT
ATGGGTTGTTCTCGGCA
apyr2[long tail]-ATTTCCAGTTTGAATCTGA−26068
[short tail]-ATTTCCAGTTTGAATCAGT
GCTTTTAAGTCTCGTTTTCG
  • The sequence of the long tail is 5′-GCGGGCAGGGCGGCGGGGGCGGGGCC-3′ while sequence of the short tail is 5′-GCGGGC-3′. Also listed are the map locations for each gene.