TABLE 3

Ninety-one selected cytochrome P450s (CYP), esterases (CCE), or glutathione transferases (GST) and various oxidase genes and associated primers and conditions for PCR amplification

GeneVector baseContigForward primerReverse primerTaProd. size
Polymorphic by SSCP
Esterases
    CCEae1oaAAEL0043411.115AGGTCCAGAAGCCAAACAGGGGAAGCAGGTGTAGGTTCAGAGTA61394
    CCEae1AAAEL0051131.142CAAGAGTTGCCACTGGATGAATAGGCTGCCATTACGAACA52147
    CCEae5AAAEL0051231.142ACTTGGCTTTCTTTGCCTACCCCGCTTTGAGCGATTACTTTAT52222
    CCEjhe1FAAEL0052001.145TTGTGATGAGTGGGAATGCGTCGGTACAGTGTCAATGGGTCT57218
    CCEunk7oaAAEL0087571.347ACGGAGTCTTTCTTGAAGGGTAACACTAACTGCACGAAGCGATG61318
    CCEunk4oAAEL0015171.35CTGCTGCTGCCACATACCCGCCGTGCTTCCAATC57347
    CCEae2DaAAEL0103891.474CGAGCGATTGTTATGTCTGGAGCCCTTCTTCCGAGTTTC57344
    CCEae4BAAEL0023761.55AAACCCGAAGTGGCTTGTGCTCTTGGTAACCGTGGC61359
    CCEae6BAAEL0023781.55CCATCGCAAAGCACCAGTCAATAGCAAGCATTCCCTC61205
    CCEbe2oaAAEL0125091.704AGAAATCCGCCGAGAAAGCGGAGTAAGGGAACCTGATGGAA61267
    NS-COE1AAEL0032011.81TATGACTAATCTTCCCATCACTCCAGATAATGACCCGCAACCAAGT57212
Cytochrome P450s
    CYP304C1AAEL0144131.1104CTTCCATTCGGTGCGGGTAATGTCGTCGTGGTTAAAGGGTTAGTT61277
    CYP301A1AAEL0145941.1181CAAGAGTGCCACAAAGCGTATGACAATCACGGTACTGTAAACCCTAAGAA61338
    CYP9J24AAEL0146131.1188ACTTCGCTGCTCTACACTTTACTTGATTCCGTTTCCTT52211
    CYP9J26AAEL0146091.1188GAAACGGCGGAGCATGTCCACCTTGATTCCAAAA61370
    CYP9J27v1AAEL0146161.1188GATTCGCCACCGTTCAGAGTTTCGGATACCACCAT61202
    CYP9J28AAEL0146171.1188TTTGCGAACGATGTGATGTTCCCGCTCCCTAAT52263
    CYP6F2AAEL0146781.1219CGAACGCAGCAAACAATGGCCGTGTTGTAGCGGGCAAGGAT61305
    CYP6BB2aAAEL0148931.1327GTAGTCGCTAAGGACGGAGGAGAGATCGTGGTGCATCGAGTGG61240
    CYP6CD1AAEL0050061.138GAAGTTGACCGTTGGATGCGTGGTGTAATCCGTAGGCTTTCC61252
    CYP325R1aAAEL0057751.174GTGCTACGGTGTTCCTTGGTCCTTTCGGTTGGGTTTCC61214
    CYP9J10AAEL0067981.221AGGGTTCGTTGAGGCAGGTTTACCGTTCAGTGATTT57389
    CYP9J15AAEL0067951.221AAGGGCAACCTGAAGCACTCTGTCCTCGTACAAACGGGACTGAA61359
    CYP9J19aAAEL0068101.221TGGACGGATAATGAGTTGATGTCTATGGTCGGAGGC57266
    CYP9J8v1AAEL0068111.221CTTCGCTGCCGTTATCTTTGACACCGATTTGCTTG57381
    CYP6AG5AAEL0069841.231CTAACGAAGTCGGAGGAACGGGGCAATGGACGAAATGA57287
    CYP4H32aAAEL0078121.283CGCTGCGATTACTTCCACCTCGAACGACCGTCATCTTCA61282
    CYP9M4AAEL0013201.29CGTCGCAGCCTTCTTAGTTTCCCAATGATAGGGTCCACCT57384
    CYP4C52aAAEL0080231.295TTCGACATCGTGCCCTTCACTTCTTGCGACAGCAACTGGTTA61255
    CYP4G35aAAEL0083451.318GCTTGGCGATGGGCTGTTCATAATCAAATCCCTCCTTGCTCT57304
    CYP6P12V2aAAEL0148911.327GGCAGGTCACCAACAAGCAATCACCGATTCCCGCTCCC57380
    CYP9J32aAAEL0086381.352TCGGGTAATGGGACTAAGACTCCGTTGTTTCTTGTT52211
    CYP6AL1AAEL0088891.354GCGGCTCAGGTGTTTGTGCGGCTGTGCCTTTGTCTAT61350
    CYP6N9AAEL0091211.371GAAAGCATCCGCCAGCATGCAAGGTCGCCAATCCC63354
    CYP9M8aAAEL0095911.41ATTGAGTGGACCGATTACGACAGGATTCGGGAAGAAATGTGG61358
    CYP6AL3aAAEL0096561.415ATTTGATTACTTCGCTCCGTTTGGTGCCTGGATGTCCTGATGTCG61291
    CYP6AG8AAEL0156541.4359TGACTGTTCTCCCGAGTGTTGGGTTTAGCGAAAGGGTGGC61338
    CYP4AR2AAEL0101541.457CACTTCGCATGTTCCCTCCTCTTAGTGGCATTTCGTCCTG61208
    CYP325Z1AAEL0102731.467GGTGGGCAACGAAACATCTACAGCAGCAAACGGGACAGC57271
    CYP12F5aAAEL0019601.47TTTGGAAGTCACTGGCGTAATTTGGGCATCGGTGTTTGT57233
    CYP305A5AAEL0020431.48GGATTGTACGCTGGGAGGAAACTTTGTATGGCTTTGGTGAGA61256
    CYP302A1AAEL0114631.581AAAAGACTGCCGTTGAGTTGGGAGATAGGGTTGAGCCGAAGAG61245
    CYP303A1AAEL0121441.66TTGGTGAAGGCAGGAAACGTGAATGGAAAGTGGCTGAAAA57282
    CYP6BY1a1.7TCACGCCGCTGTTCCTATTCCGCCACTTGTTACCTTCG61247
    CYP6P12V1aAAEL0124911.702GGACAGTCGGAAGCGGGAGTGCAGCAGCAAGTTCATAAAGTCGT61311
    CYP325M1AAEL0127731.738TTGCCGACGGGCTCAATGGCGGGTCCTAAAGATGA61210
    CYP4H30aAAEL0033991.85CAATCCGCATGTTCAAGACAAAATCGCTGACCAATACAGTTCC61264
    CYP4J13AAEL0135551.869ATGGAGTCTACAATCTGTTTGGGTATAACCTGCTGCGGTCGTGTC61319
    CYP9AE1aAAEL0037481.96CATCCTTATCGGCTTCCAGTTTTAAGGTGGCGAGGTTTCTGCT′361392
Glutathione-S-transferases
    GSTx1AAEL0000921.1CCCAAATCAACCGAGTTCTTCAGCCTGGTCCTCCTCGTATCCT61322
    GSTd2AAEL0010781.22TGGCGTTGAGTTGAATCCGTGCCTCCGCAAATCGTG61268
    GSTe2AAEL0079511.291CACCCTGTCGGGCAGTGGAATTGGCTTGCTTAACCAGTTCTTTC52308
    GSTe4AAEL0079621.291TATTGGTTTGGACCTGGATGTTATAGATGATGATGGCGTGGC57229
    GSTe5AAEL0079641.291TATGGGAAGGACGATAGTTTGTAAAGTCATCGGTCAGGGCATC57279
    GSTe6AAEL0079461.291CGATGCGGTTCTGCCGATAAGCCAATTTCTTTGCACCTTCTC52208
    GSTe7aAAEL0079481.291TGTTTCCGAGACTGCGTGACTGTTCCATCCGTTTA52372
    GSTt3AAEL0090201.362CAGAACGTGAACCGCTTTGGGACCTTCGCCTGATTGACTTCCA61260
    GSTz1Unannotated1.632AGCGTGCCAAGGTTCGGGAGAGGATGATCGGATACGGGCGTAGAT61276
Monomorphic by SSCP
Esterases
    CCEunk5oAAEL0005461.1CACGGAGATGATCTGGGCTACGCTTCAAGACGGGAACACCTAT57308
    AaeCOE-15AAEL0040221.105GATGACGGGCGTGGATTGGGCTGTTACTATGGCAGGAAGAT61372
    CCEae4AAAEL0051011.142CGAACTGACTCGGCTACTTTCTGCTGCCCTTCTTTACGG50248
    CCEglt3HAAEL0009051.18TGGTGCTGTCGCTGTTTCTGCGTAAGGGTATCCACGGCTAAT61275
    CCEae3BAAEL0023851.55GCAACCCTCCAAGCCTTAACACCATTGTCCTTCCTACGC57359
Cytochrome P450s
    CYP325AA1AAEL0040121.105AACGATGCGGCTCTACCCAGAACTTCAAATCCTTTCGAGTCAAT57346
    CYP6CB2AAEL0028721.1337ATTGCCCATTCGTGCTCTGTCTCCTCCGTGTTCCCTTTT57282
    CYP6AK1AAEL0049411.136TCTCGAAAGACAATGCAGACAACTCCAAATCGGCGTACAATCC61229
    CYP325X1AAEL0056951.17TGATACCGAGGAGGAATACAATAAACGGGCCACATAAGGCACAACC61335
    CYP325Q1AAEL0060441.187GAATGATGAAACCGATGACGGCACTCCTCCGCAAAGC61386
    CYP307B1v2AAEL0068751.224CTCAACAACTACGACCTCAGCATGAGCCCACCGGAACGAA61248
    CYP4H29AAEL0078301.285TTCATCCATCCGTTCCAATCATCTATCGTGGCACAATCTTCACA61393
    CYP49A1AAEL0086381.338CAGAACCCAGACAAGCAGGAACCGTAACCGAAGGGCAAACTA612000
    CYP307A1AAEL0097621.427GGCGAAGACGAACCAGAGCGGGCGATGAGGAGTACCGAAGGA61308
    CYP9M9AAEL0018071.43CGGCACCAAGGTAACGGCATCGGCACATCGGTCTTT61280
    CYP12F6AAEL0020051.47ATGATTCTGGCAGGTGTCGGTTTCCTACTATGGGTGG52220
    CYP314A1AAEL0109461.524TCCGATACAATCACCAACAATGAATGGAAGCACCAAAGACGA57305
    CYP325S1AAEL0003261.6TGAATTTCTACGGAATATGGAAGGAACGGACGACTGCTGTTGG57279
    CYP315A1AAEL0118501.622TTTGAAAGGATAGTGCCAGAAGGAGCAATAGGGAACAGACG57323
    CYP6AA5AAEL0124921.702GCCCGTCATTCGCACAGTTTCAACATCCAGCCAAAGTCC61210
    CYP4H33AAEL0137981.923CCTGATTCGCACTACCTGTGAACTCATCCTTTCCTGCCTTA61395
    CYP4J17AAEL0140191.985CCAGGAGGAATGCGACAAACTACCTAACAGGCGGTAGGGAAAT57250
Glutathione-S-transferases
    GSTt4AAEL0042291.111CCAACGGCGTCACCATTCTCGCTGATTCAGGTTCTGCTCCATCT61246
    GSTe1AAEL0079541.291TTTCCTTTCCCTAAGTTCCGTCTCCAGCACAAACCCATCATCGTC49179
    GSTe3AAEL0079471.291CTGGTACAGAAATACGGCAAAGAGAACAGGGCATTCAGAGTGGA57297
    GSTx2AAEL0105001.481CGAGGCATCATCAACCAACGGTCGGCAGATCACTCAGGTCAACA63268
    GSTi1AAEL0117521.608GCCGCTTGGGAAGTAAGTTTGTGATGGGATGAATTGGGTGCT61255
  • Ta, annealing temperature; Prod. size, product size (bp).

  • a Genes that were placed on the linkage map in this study.