TABLE 2

Genetic markers with known linkage locations (Black and Severson 2004) in the Aedes aegypti genome and associated primers for PCR amplification

Position (cM)Marker nameVector base geneForward primerReverse primerTaProd. size
Chromosome I
    5cathbpAAEL007599CAAATTCGGAACCTCACCAGTATCCACCCTTGCATCCATC60343
    10transferAAEL015458ATGCGGCCATCCAGGTTCAGCCCGCCGACTTCAGTTTCGT60309
    48ARC2AAEL010625ACTACTGAGATAGGACGGAAGACCACTTGGACTTGGAGGT57260
    54APNAAEL012783TCCATCACGGCAATCACAAGATCCAGCCAGCATTCG57203
Chromosome II
    28mucinAAEL004798GACAGCACCCACAGGCAAATGCTCCTTTCAACGGGACCTT60408
    43chymoAAEL014188CCAGTTTGGCACTCGCTTCCGACGGCAATGTCATCGGGAC60319
    70sin3AAEL014491GTATCTGTTCCTGCGGTTGCCCTGAAGTGCTGCTTCTGCT58454
Chromosome III
    21maltAAEL009524GGACTGGTGGGAACATGGAACTTATCGGACAACCGCTGGA48234
    26vitgCAAEL003652TGCACAGAAGACCACCAATGTCGACTGTTCCGCTGAGTTA60287
    32paraAAEL006019ATGTGGGATTGTATGCTTGGATGAACCGAAATTGGAC56370
    46UGALSAAEL010434AGGGCTACAATCCTGGCTATGTATTCTGGCTGCTTGACGT60328
    57apyr2AAEL006347TGATTGCATCGTCGTTGATTCAACTTGCGCTGTTTGTTTT54317
  • Ta, annealing temperature; Prod. size, product size (bp).