TABLE 2

Sequences of the primers used for real-time PCR

GeneForwardReverse
ACT1GAAAAGATCTGGCATCATACCTTCAAAACGGCTTGGATGGAAAC
CLN1GAAAACTGGGTTAATTGTCACTGCGTTTGATGAGGATTCATCTCCG
HTB1GGTAAGAAGAGAAGCAAGGCTAGAAGACTTCTTGTTATACGCAGCCA
HTA1TGTCTTGGAATATTTGGCCGTGGATGTTTGGCAAAACACC
HTB2GTCGATGGTAAGAAGAGATCTAAGGGTGGATTTCTTGTTATAAGCGGC
HTA2GCTGTCTTAGAATATTTGGCTGCGGCAACAAGTTTTGGTGAATG
HHT1GCTTTGAGAGAAATCAGAAGATTCCGCAGCCAAGTTGGTATCTTCAA
HHT2CTGTTGCCTTGAGAGAAATTAGAAGGCAGCCAGATTAGTGTCTTCAAAC
HHF1 and HHF2TAAAGGTCTAGGAAAAGGTGGTGCTAACAGAGTCCCTGATGACGGATT
Intergenic between HTB1 and HTA1TTTGCCACTACTAAGGCCAAAGCTCGGCGAGTTCAAATTT