TABLE 2

Deletion breakpoints and the relative positions to nearby genes

BreakpointsInitiation siteaDistanceb (bp)
StrainDistalProximalDeletion size (bp)Gene
1459,374,6709,377,0852,4169,374,984Hsp23314
349,370,7919,377,0856,2959,370,527Hsp26264
2359,370,5339,377,0856,5539,370,527Hsp266
2479,370,5089,377,0856,5789,370,527Hsp2619
1259,366,8039,377,08510,2839,367,130Hsp22327
3219,366,7449,377,085c10,3429,367,130Hsp22386
2049,366,6749,376,306d9,6139,367,130Hsp22436
  • a Nearest transcription initiation sites and genes.

  • b Distance between the breakpoint and the nearest transcription initiation site.

  • c The deletion contained a 26-bp imperfect duplication of the 31-bp-P-terminal repeats at the 5′-P end, GGACCACCTTATGTTATTTCATCATG.

  • d The deletion contained an extra trinucleotide, ATG, at the junctions of the deletion breakpoints. The sequence at the junction is AAGTTCTTGACTACACCCATGATGAAATAATTACGTGCATGCACACAT, with the extra trinucleotides underlined.