TABLE 1

PCR primers used in this study for 16S rRNA gene amplification

ApplicationNameSequence (5′–3′)Reference
Isolates identification63FCAGGCCTAACACATGCAAGTCGTTMarchesi et al. (1998)
1492RTACGGYTACCTTGTTACGACTTLane (1991)
Total community DNA, library construction8FAGAGTTTGATCMTGGCTCAG
1387RGGGCGGWGTGTACAAGGC
Total community DNA, DGGE analysis968FGC-Clamp-AACGCGAAGAACCTTACHeuer et al. (1997)
1378RCGGTGTGTACAAGGCCCGGGAACG
341F (GM5)GC-Clamp-CCTACGGGAGGCAGCAGMuyzer et al. (1993)
907RCCGTCATTCMTTTRAGTTT
GC-ClampCGCCCGCCGCGCCCCCGCGCCGGTCCCGCCGGCCCCGCCC
Archaeal primersARCH344FTCGCGCCTGCTGCICCCCGTGiovannoni et al. (1988)
1406RTGYACACACCTCCCGTOlsen et al. (1986)
ARCH519FGWTTTACCGCGGCKGCTGLane (1991)
ARCH915RGTGCTCTCCCCCGCCAATTCStahl and Amann (1991)