TABLE 1

Primer sequence and localization

Primer pairPrimer nameSequenceLocalizationAmplification product
Pair 11ftcagaaagtgagataagaaaagacaagcLgals4 and Lgals6 intron 4Lgals4, 305 bp
1rgccccagtgaccaaggtattaagcLgals4 and Lgals6 intron 4Lgals6, 82 bp
Pair 22facataggacccagtgtctgagaaggLgals6 intron 4Lgals6, 142 bp
2ratccaacatgtcttcatccctttccLgals6 intron 4
Pair 33ftaagatttcacttctttgcccaaactgtccLgals4 and Lgals6 intron 3Lgals4, ∼2000 bp
3.1rtcacagagatccacttgcctctagttctccLgals4 intron 4Lgals6, ∼1800 bp
3.2ratccaacatgtcttcatccctttcccaaccLgals6 intron 4
Pair 44fgttacatagcgtgtggggtcaggLgals4 5′-UTRLgals4, 1013 bp
4ragttgatgacaaagttcctggctgtLgals4 exon 8–9's junction
Pair 55fggtacaaccctccacagatgaacacLgals4 exon 6Lgals4, 522 bp
5raactcggggatctttctgcttccLgals4 and Lgals6 3′-UTR
Pair 66fgttcagacattcctgtggcctagcLgals4 and Lgals6 5′-UTRLgals6, 954 bp
6rggaagatcccaccctgaagttgat5′ of Lgals6 exon 9
Pair 77fgaaaccaaatatccggccatgaLgals6 exon 4–7's junctionLgals6, 505 bp
7rcattttattaggagcttagatggaactcgLgals4 and Lgals6 3′-UTR