TABLE 1

Primers used in this study

Primer nameSequencePurpose
URA3extF5′ ATCAAAGAAGGTTAATGTGG 3′PCR
URA3extR5′ TCATTATAGAAATCATTACG 3′PCR/sequencing
URA3extF35′ TTGATTCGGTAATCTCCGAG 3′Sequencing
URA3intF25′ TGGGCAGACATTACGAATGC 3′Sequencing
URA3intR25′ CAAACCGCTAACAATACCTG 3′Sequencing
CAN1extF25′ TCTTCAGACTTCTTAACTCC 3′PCR
CAN1extR25′ ATAGTAAGCTCATTGATCCC 3′PCR/sequencing
CAN1ext/intF15′ AAAAAAGGCATAGCAATGAC 3′Sequencing
CAN1intF25′ GACGTACAAAGTTCCACTGG 3′Sequencing
CAN1intF35′ TCAAAGAACAAGTTGGCTCC 3′Sequencing
CAN1intR25′ TAGATGTCTCCATGTAAGCC 3′Sequencing
CAN1intR35′ AACTTTGATGGAAGCGACCC 3′Sequencing