TABLE 1

Primers used for creating constructs

Primer nameSequencea
SME-STARTdel5′-CAATGACAGTTAATAGGTAAAGTTACTAGTAACAAAGTAAATTTTAAAACGGCTAGC-3′
SME-Sac5′-GGGGCGGAGCTCAACTCATTCAACACTCGG-3′
SME-BamHI5′-GGGGCGGGATCCGCGTCAAGGCCACAGTCAGCTCTAACGC-3′
SME-C69V-Top5′-GCGGTTCCCTTTAGTCTCAAGCTTTAAAGGTTTTTTGGCGGCTGC-3′
SME-C238V-Top5′-GGTGACAAAACTGGGAGCGTTGGCGCCTATGGTACTGCGAATG-3′
SME-E166Q-Top5′-GGTTAGATCGCTGGCAGCTGGAACTTAACACTGC-3′
SME-E166Q-Bot5′-GCAGTGTTAAGTTCCAGCTGCCAGCGATCTAACC-3′
SME-S70A-Top5′-GCGGTTCCCTTTATGCGCTTCATTTAAAGGTTTTTTGGCGGCTGC-3′
SME-S70A-Bot5′-GCAGCCGCCAAAAAACCTTTAAATGAAGCGCATAAAGGGAACCGC-3′
PDbla15′-CGGGGAGCTCGTTTCTTAGACGTCAGGTGG-3′
PDbla25′-CCCCGTCTAGACTTACCAATGCTTAATCAGT-3′
TEM-AgeI-Top5′-CATTTTGCCTACCGGTTTTTGCTCAC-3′
TEM-AgeI-Bot5′-GTGAGCAAAAACCGGTAGGCAAAATC-3′
TEM-SME5′-GCCTACCGGTTTTTGCTAACAAAAGTGATGCTGC-3′
Pbla-ssSME-Top5′-CAATAATATTGAAAAAGGAAGAGTATGTCAAACAAAGTAAATTTTAAAACGGCTAGC-3′
Pbla-ssSME-Bot5′-GCTAGCCGTTTTAAAATTTACTTTGTTTGACATACTCTTCCTTTTTCAATATTATTG-3′
ssSME-mTEM-Top5′-GCTTTGTCGGCATTTAATGCTCATGCTCACCCAGAAACGCTGG-3′
ssSME-mTEM-Bot5′-CCAGCGTTTCTGGGTGAGCATGAGCATTAAATGCCGACAAAGC-3′
pyrF-bla-top5′-CACGCGATTGTCGTCTGAAGGTCGGCAAAGAGATGGTTTCTTAGACGTCAGGTGGCACTTTT CGGGGAAATG-3′
pyrF-bla-bot5′-GCGGTGCATCTTTGCCAAACGGAACCAGTGCCTCTTACCAATGCTTAATCAGTGAGGCACCTA TCTCAGCG-3′
SME-1STOP-pyrF384bot5′-GGCTTCCATGCTGGTCAACACTGTCAATTAATCAATTGCCTGAATTGC-3′
  • a Engineered restriction sites utilized for cloning and/or screening are underlined.