TABLE 1

Loci studied, distances from the S loci in A. thaliana, and primers used for the PCR amplifications in A. lyrata

Data from A. thaliana Columbia strain
Locus namePosition on chromosome 4Distance from SRK (kb)3′ or 5′ of SRKPrimersPutative function
S2At4G201305043′F: tcacttctggcggctctatgRibulose-1,5 bisphosphate carboxylase/oxygenase large subunit N-methyltransferase related
R: tctttaggacgccaatgtag
S4At4G207602553′F: gatgcttgcttacgaggttaShort-chain dehydrogenase/reductase (SDR) family protein
R: gccgctgtcttgtttcttag
B80At4G21350273′F: gaatcagcagcttcaaccaaaU-box domain-containing protein
R: gttatcctccaatcgggtcatac
B120At4G21390105′F: gat cttaggatccacaagctcctcS-locus lectin protein kinase family protein
R: ctcgaagatggacgtgagatag
S8At4G218001895′F: accttccccactgttgtcacATP-binding family protein
R: aaagtcctcatcatcctcctc
S12At4G227205545′F: acaccgccaactatcaaaacGlycoprotease M22 family protein
R: tttcagccattgttgttagag