TABLE 1

Primer pairs used for PCR screening

Primer pair (5′ to 3′)Target gene (fragment size)Target groupAnnealing temp. [Mg+]
10F AGTTTGATCATGGCTCAGATTGa16S rRNA (∼1500 bp)Most bacteria60° [1.5 mm]
1507R TACCTTGTTACGACTTCACCCCAGa
27F GAGAGTTTGATCCTGGCTCAGb16S rRNA (∼1470 bp)Most bacteria55° [1.5 mm]
1492R GGTTACCTTGTTACGACTTb
559F CGTGCCAGCAGCCGCGGTAATACc16S-ITS-35R (>1000 bp)Most bacteria (not Wolbachia)58° [1.5 mm]
35R CCTTCATCGCCTCTGACTGCd
10FF AGAGTTTGATCATGGCTCAGGATGc16S rRNA (∼1300 bp)Cytophaga–Flavobacterium–Bacteroidetes58° [4.5 mm]
1370R CGTATTCACCGGATCATGGCe
63F GCCTAATACATGCAAGTCGAACd16S rRNA (∼450 bp)Spiroplasma and several Gram-positive55° [1.5 mm]
TKSSsp TAGCCGTGGCTTTCTGGTAAf
WspF TGGTCCAATAAGTGATGAAGAAACTAGCTAgwsp (∼600 bp)WolbachiaTouchdown 65–55° [1.5 mm]
wspR AAAAATTAAACGCTACTCCAGCTTCTGCACg
CLOf GCGGTGTAAAATGAGCGTGh16S rRNA (∼450 bp)Cytophaga-like organism57° [1.5 mm]
CLOr1 ACCTMTTCTTAACTCAAGCCTh
LCO-1490 GGTCAACAAATCATAAAGATATTGGiMitochondrial COIMost invertebrates45° [5 mm]
HCO-2198 TAAACTTCAGGGTGACCAAAAAATCAi
  • a Munson et al. (1991).

  • b Lane (1991).

  • c Russell et al. (2003).

  • d Unpublished.

  • e Moran et al. (2003).

  • f Fukatsu and Nikoh (2000).

  • g Jeyaprakash and Hoy (2000).

  • h Weeks et al. (2003).

  • i Folmer et al. (1994).