TABLE 1

Oligonucleotides used for PCR-based recombinant mapping

a1 haplotype
Primer nameSequenceaPolymorphismα-Yz1Abβ-Sh2ca1∷rdt sh2
αSNP4RGTGTGGGGTCTAGAGAAGGGSNP+de
αSNP5RGCTTGAGGATCGAGTAGTGCSNP+
αIDP1RTGAGAAACTTCTTTCGGCTCTGIDP+
αSNP6RCAACACCAAACCCTTCAACCASNP+
αSNP3RCCAGCCTTTTTATCCCGCTCSNP+
αSNP3FGCAAGAACACATTAGACACGTTASNP+
β3694RGTCTTCCCCACATAATATGCGSNP+
β3040RCGAGGAGCAGACGTAGCGGSNP+
β2149RCAACGTTCGCTGCAGGACSNP+
yz4725AAATGGTCAGGATAGCTTAGTTIDP++
yz5U-AbRGGCTCCATATATCAAGCACAIDP++
Sh5379RACCAATGATACAGAGAGGCGSNPNAf+
rdt444AGCAAATAGCAATAATCAAGGCAIDPg+
rdtILR1AGACAAATGTTCTGTAGGAAACSNP+
yzrdtIDP1GTTCACACAAAGTATTTTTTTCGIDP+
yz1410RGGCTCCATATATCAAGCAGTIDP+
Shrdt1RGACCAATGATACAGAGAGGCASNP+
QZ1504CCAGGGGATAAAACAATTCGTU+++
A2775FCACCATCATCCCGACGCTCU+++
A2357AGCCGACGGTGGAAGGGATGU+++
XX390hTCGGCTTGATTACCTCATTCTU+++
A6458fGGGAAGACGAAGCCATTGAU+++
QZ1265hTACTCCTCTCCAACTCCAU+++
A1522GGGAGTTTGGAGTTGGAGAGGU+++
ajl002TCAAGCTAAAAGAAAGAAACATTU+++
a178RTGCCAAATAACCATACCACAU+++
QZ1742TAGTTGGTAGCACGGTTGAU+++
yz3UTRFCGGGGGTTGCAGTCATTGACU+++
ZH1748CACATCCCCGTCTCCTU+++
yz792FGCGGTTGCGGCTTGTACU+++
MY339GCCTTTCCCCCATTACTATCU+++
  • IDP, insertion/deletion polymorphism; SNP, single-nucleotide polymorphism; U, universal primer.

  • a Sequences are listed 5′–3′.

  • b Sequences specific to the interval in A1-b Sh2 extending from α to Yz1A.

  • c Sequences specific to the interval in A1-b Sh2 extending from β to Sh2.

  • d + indicates a primer that can amplify the corresponding interval.

  • e − indicates a primer that cannot amplify the corresponding interval.

  • f Sh2 is not within the α-Yz1A interval. NA, not applicable.

  • g Primer specific to the rdt transposon insertion.

  • h Both primers (XX390 and QZ1265) amplify in each of the three haplotypes. In combination, however, these primers amplify a product only in the α-Yz1 interval.