TABLE 1

PCR primers used to generate reporter constructs

PCR fusion primersa
PromoterA primerA* primerB primerResulting transgenic arraysb
gcy-1gaagctggagtcaagtgtggtgtactacaacaagggactttgagtcgacctgcaggcatgcaagctgaatatttgcatcgaaaagotEx2419, otEx2420, otEx2421
gcy-2ccattacagggacatcagggatacattgaaagtagcgagtcgacctgcaggcatgcaagctgaccattttgaattaatgattccotEx2312, otEx2313, otEx2314
gcy-3gagctctcatggatcacgcacattgaaagtagcgaattagagtcgacctgcaggcatgcaagctgttttttcaaacaaagatcagotEx2422, otEx2423
gcy-4gaagtttcagtggtacttgcgattgattcagaattcgagatcagtcgacctgcaggcatgcaagctgagtatcataattcatggaagtagotEx2407, otEx2408, otEx2409
gcy-9gttatctccgatagccaagggttgttgaaagccatatcagtcgacctgcaggcatgcaagctcggaagtggatagatggotEx2307, otEx2308, otEx2541,c otEx2542c
gcy-11ctgatttgatgccatcacgatttgtctcttcactggtcacagtcgacctgcaggcatgcaagctgtccagcatgcttctgcotEx2304, otEx2305, otEx2306
gcy-13gccacaatgacaattatctcctcaaaatccattgtgtaagttcagtcgacctgcaggcatgcaagctccatcctacagaggaggcotEx2410, otEx2411, otEx2412
gcy-14gtgcattaatcagaatgagccagaacactgaaagctaccagtcgacctgcaggcatgcaagctgcacatgttagatgatgaatgotEx2322, otEx2323, otEx2324
gcy-15gttatcctaatagcaactacatcacccttcaataatagtttctctcacttgagtcgacctgcaggcatgcaagctcgcaactgttgcattgotEx2497
gcy-17cagttgaacatctccctggcaacaacgttcaagctccagtcgacctgcaggcatgcaagctcatcatgttcttagagtaggcotEx2413, otEx2414, otEx2415
gcy-18ccgaaagaagtcgagttgggtcgagagcagcaaatcagtcgacctgcaggcatgcaagctcattttctgatgctccgacotEx2498d
gcy-19gataccgtgagcaagatgggatagattgcattgttgtggagtcgacctgcaggcatgcaagctggacattggccatcctatacotEx2309, otEx2310, otEx2311, otEx2535,f otEx2536f
gcy-20gatgatttatacccacatacattgggagagttttcaatgatttgagtcgacctgcaggcatgcaagctccgcattgttgaatgaacotEx2325, otEx2326, otEx2327
gcy-21gtaaactgggagtgaaagcctcgacgagcattatgtgagtcgacctgcaggcatgcaagctctgaaagcatagcagaataatatgotEx2416, otEx2417, otEx2418
gcy-23caaacatcttacgcttctcacctcgagtgtcgacacgagtcgacctgcaggcatgcaagctccaacttttacctttaaagttaatgotEx2499, otEx2500, otEx2501
gcy-25caagattcgatttcaaaactgccaacctgattttgtggagtcgacctgcaggcatgcaagctgagaagcatctccgaatgotEx2424, otEx2425, otEx2426
gcy-27gatactttggaaaagaacaatgcgaatagacaaccaaacttcagtcgacctgcaggcatgcaagctgttgtatctcgagaaagactctgotEx2502,c otEx2503,c otEx2540c
gcy-28caagacctccaaagttttgcggtcttgaagcgattcagtcgacctgcaggcatgcaagctgagcatagcctcataggtacotEx2504, otEx2505, otEx2537
gcy-29cacagacaagcagagcacgcaaacgagtcccagcagtcgacctgcaggcatgcaagctgagcattttttactgtttttcotEx2490, otEx2491, otEx2492
Subcloninge
Promoter5′ primer3′ primerResulting transgenic arraysb
C.b.gcy-4ttaagcttAAAACGTATCCCTCTTCCTttggatcCTAGATGGCTGAGATCTACGotEx2506,f otEx2507,f otEx2508f
otEx2509, otEx2510, otEx2511
C.b.gcy-19ttaagcttGCCGCGGTTGAAAACAAAAATTGttggatccAATACTTGGCGAGTAGCCCCotEx2138,f otEx2139,f otEx2140f
otEx2141, otEx2142
  • a Primer nomenclature according to Hobert (2002). All sequences are 5′–3′.

  • b If not indicated otherwise, C.elegans animals containing the otIs151 transgene were injected, using unc-122∷gfp as injection marker.

  • c Injection was done into N2 animals, using rol-6(d) as injection marker.

  • d Injection was done into otIs133 animals, using rol-6(d) as injection marker.

  • e Primers used for subcloning contained restriction sites at their end and were subcloned into pPD95.75.

  • f Injected into C. briggsae, using rol-6(d) as injection marker.