TABLE 2

PCR primers used to survey genetic variation in C. disseminatus

GenePrimerSequence 5′ → 3′
PAB1CdPAB1-FCGTACGACTCATTCACACACAA
CdPAB1-RACGGACTCTGGGTGGTACTG
GLYDHCdGLYDH-FTATCGACTGGCACTGCAAAG
CdGLYDH-RCAACTACCGAGGGCAATCAT
MIPCdMIP-FCTGCGGGCAACTGGRAACAA
CdMIP-RGAAGGACGTCTCTGGCACATA
CDHHCdHH-FACTGTGGAGGCAAGTCGAAG
CdHH-RCAAACTTCTGCCACTCAGCA
CDRFCdRF-FGTTCCCATCCCAACAAACTG
CdRF-RAATAGGAACGCGTCTGAGGA
YPL109CdYPL109-FAGGCACCTTTGAGCCTCTCT
CdYPL109-RACCCATACCCACACCTTCAA
RPB2CdRPB2-FAGCCGACGGAGATACATGAC
CdRPB2-RCGTATTCGTTACGCACAGGA
CDSTE3.1CdSTE3.1-FCATCGCTCCTGTATGGTGTG
CdSTE3.1-RCTGGAGAATAGGGACGCAAA
CDSTE3.2CdSTE3.2-FTCGATCGTATGGAACGRTAA
CdSTE3.2-RAKCGTCTAGGYGTGAGGTTC
CDSTE3.3CdSTE3.3-FCCCATTTGGTGTGACATCTG
CdSTE3.3-RGGTCAAGAGCTGGCTGAACT
CDPHB1CdPHB1-FTACCGAAGAATCAGGCCTCT
CdPHB1-RCGATGTTACAGAACGCACCA
AαCdα-FGGCGTATATCAGCTGCCACT
Cdα-RCCCYTCCTTTCGATCTTTTC
AβCdβ-FAGGCCGAAAAGATCGAAAGG
Cdβ-RGGCACGGAGAAGATTTYACTGG