TABLE 1

New markers used to genotype the three populations

Marker nameBACPrimer 1 (5′ to 3′)Primer 2 (5′ to 3′)
F12A24bF12A24GGTGTGATGTCGACCGGTAAAGTGCACAACGTGCTCTCCATG
F17A22F17A22ACACACGAATATTGATTGTCTAAGGTCACTTGTCGGTTTGTGTGG
cF7M19F7M19AGCTTGTGTCGTTTCCGATAGAGTTGCAGAAATAAGCAGTGGC
F8D20F8D21CTTAAATGCCGATCCAGTCGAGGTTCATTCGCGCATTTATTGTTGC
K15I22K15I22TCGGTGGTTTACTTTCACTTTGAATTGTAGCTTCTTCTGAACC