TABLE 2

PCR primers used in this work

OligoSequence (5′–3′)
P1-5fGTAACGCCAGGGTTTTCCCAGTCACGACGCCAAGAACGAAATGGCCCTC
P1-5rCCAAAAATGCTCCTTCAATATCAGTTAACTTCTGTCGTTGTGAACGAGAC
P1-3fGAGTAGATGCCGACCGGGAACCAGTTAACCCAAGCTGTATCAAGAATACG
P1-3rGCGGATAACAATTTCACACAGGAAACAGCTCCTAGAGTGGTGTTCTTGTG
hph-fGTTAACTGATATTGAAGGAGCATTTTTGG
hph-rGTTAACTGGTTCCCGGTCGGCATCTACTC
Prez31TCACATCCAGCGACCCGTGCT
Prez32GAATTCGGGGATGCTGAGCACAGTGG
Prez33GGGCCCGTGAGAATTGAGTGGACAATTG
Prez34GGCCCGTAGTTATAAGGGGTGTCAAGA
sa11CCATGGTGATGGTTTTAGGGTTGTTTGATA
sa12CCATGGTGCCGCGTGGGTGGTCATC
sa13GGGCCCTCACAGTTGTCTTGAAGGG
sa14GGGCCCGTTCAGTCTGGCATTTCTGG
trpC1GATCCGCCTGGACGACTAAACC
hph3ACTCGTCCGAGGGCAAAGGAATAG
P1-1ATGAACAACACTTTCTACACCACCG
Pko-rTCCTTCTGGGAAGACCACACG
Prez36GACAATAAGACATTCTGGATGTCTC
Prez35GTCGATGCCTGCACGCGCGAA
sa10CGGAGTGAAGTTGCCGTTGCCG
sa15GATATCTGTTGATGTGGTTTCATG
MrezS2AGTATACGAACCGCGAAGACAA
Mrez32TTTCTGAATTCCTCATATGGAGAA
PrezS3CTCATGACGCCCCGCCGTCGGTT
PrezS4TGGTCCACATGTGCATGACCA
C-gpdTTGGTGGTGCAAGAGGCGTTG
N-gpdGGCATCAACGGTTTCGGCCG