TABLE 2

Primers and PCR conditions

Species/geneaPrimer namebPrimer sequence (5′–3′)cAnnealing temperature/ cyclesdSourcee
Woolly rhino/12S rDNA21pheFAAAGCAAGGCATTGAAAATGCCTAGATGA55°/×40Tougard et al. (2001)
684-12SrGGCGGTATATAGGCTGAATT
Woolly rhino/12S rDNA650-12sFCCGATAAACCCCGATAAACC56°/×40This study
1085valRTGAAATCTCCTGGGTGTAAGC
Woolly rhino/Cytochrome b14228glu-2FACCAATGACATGAAAAATCATCGTT52°/×40This study
14596cytbRTTTCAGGTTTCTAGGAAGGTGT
Woolly rhino/Cytochrome b14279cytbFATGACTAACATCCGCAAATCCC66°/×40This study
15107cytbRGGGATGGATCGTAGGATTGCGTA
Woolly rhino/Cytochrome b14912cytbFCCAACATAGACAAAATCCC52°/×40This study
15446thrRCCTTTTCTGGTTTACAAGACC
Woolly rhino/Real time PCR 1WR_QPCR_415FACGTCCTACCATGAGGCCAA55°/×40This study
WR_QPCR_484RGGGATAGCTGAGAGAAGGTTTGTG
Woolly rhino/ Real time PCR 2WR_QPCR_411FGGCTACGTCCTACCATGAGGC55°/×40This study
WR_QPCR_476RTGAGAGAAGGTTTGTGATGACTGTG
Woolly rhino/Numt-166WR-PseudoFGTAAGCATATGGTAAGCAC55°/×50This study
405WR-PseudoRGCTACACTTTGGTTTATCCAACTCC
Pig / Mt. control regionL15387CTCCGCCATCAGCACCCAAAG56°/×40Larson et al. (2005)
H648nGCTYATATGCATGGGGACT
Pig / CD45PigEx9fGAGAAATACATGGATATCCCTG56°/×40This study
PigEx9rCTGGAGGTGTCTCTAAGAGG
Lion / ATP8 and num.ATP8_1FGCCACAGTTAGATACATC56°/×40I. Barnes, personal communication
ATP8_3RGAGGTGAATAGATTTTCGTTC
Moa / Mt. control region185fm-CRGTACATTCCCTGCATTGGCTC55–60°/×40Bunce et al. (2003)
294rm-CRGCGAGATTTGAACAGTACG
Moa / Mt. control region262fm-CRGCGAAGACTGACTAGAAGC55–60°/×40Bunce et al. (2003)
441rm-CRCGCATACCGGGTCTGTTTATGC
Moa / KW1 gene (sex linked)Kw1-185fGGCYRYTGCCTCAGAAATTACAG52–55°/×40–50Bunce et al. (2003)
Kw1-260rATGCTATACTGCTTTAACAGA
Moa / ADH geneAdh-230fGAGGAATTAGCTYRTTAGCTGTC52–55°/×40–50Bunce et al. (2003)
Adh-290rGGTTAACACTTTGCCAGTGG
  • a Specimen name and sequence region amplified.

  • b Primer name.

  • c Primer sequence.

  • d Annealing temperature/ no. of PCR cycles.

  • e Primer source.