TABLE 1

Characteristics of the STSs used in this study: sequences of the primers pairs, PCR conditions, expected and observed fragment sizes, sequence homology between Quercus and Castanea, mapping method, and linkage group in both species

EST nameaAccession no.Forward primer (5′ → 3′)Reverse primer (5′ → 3′)Expected size (bp)bPCR protocol (Q-C)cObserved sizeIdentitydMapping methodLinkage group Q-Ce
1T11CF369263Porth et al. (2005b)Porth et al. (2005b)555Ref.-555599Ref.-Q/SSCP-C10-10
1T12CF369264Porth et al. (2005b)Porth et al. (2005b)522Ref.-552293.5*Ref.-Q/SSCP-CNM-3
1T21CF369266Porth et al. (2005b)Porth et al. (2005b)338Ref.-577094Ref.-Q/SSCP-C1-6
1T25CF369268Porth et al. (2005b)Porth et al. (2005b)187Ref.-318797.2Ref.-Q/SSCP-C6-11
1T57CF369273Porth et al. (2005b)Porth et al. (2005b)282Ref.-528293.5Ref.-Q/SSCP-C4-2
1T62CF369274Porth et al. (2005b)Porth et al. (2005b)346Ref.-5705Q 600C91.9Ref.-Q/SSCP-C10-10
2T11CF369278Porth et al. (2005b)Porth et al. (2005b)397Ref.-5397Q 500C89*Ref.-Q/SSCP-CNM-8
2T3CF369283Porth et al. (2005b)Porth et al. (2005b)284Ref.-363094.3Ref.-Q/SSCP-C10-10
2T13CF369280Porth et al. (2005b)Porth et al. (2005b)334Ref.-533494.5Ref.-Q/SSCP-C11-3
2T32CF369284Porth et al. (2005b)Porth et al. (2005b)386Ref.-5608Q 500C93Ref.-Q/SSCP-C2-1
01A03CR627501GGTATGGGAGCTGGTCGTAAAGAGAGCCAACAGGGAGACA3821-150094.3SSCP7-5
01E07CR627526AAGCTCTAGACCTCGCTTGCGGCTGGCAGCTTGTATTTGT1451-1400Q 145C86SSCP5 E-4
02F02CR627566ACTGGAAATCGCTCAGGACTGCTGGATATCCTTGGGCATA1646-616486.3SSCP1-6
02G03CR627575ACGCTCCAAAACTTGGTCAGCGGGCAGGTACTTAATGAGG2061-170090.3SSCP3-8
06B07CR627724GTCCTCCAATTCGCCATTTAATGGGAACAGTTAGCCGATG3071-130793.3SSCP8-7
06E10CR627745TGGTGGAACCTTAGCTGACCAAGGATGACATGGCCTCAAC3331-170094.5SSCP-C DGGE-Q12-12
07A08CR627771AGCTGGGTGGAGAGAGTGAATGCGGGTATAGATGGGGTTA3417-770086.1*SSCP2-NI
07A09CR926157AGCAGCCAAGGTGAAAAAGATCAATGGCTGCTGAAGTGAG2521-130095.7DGGE5-4
07B10CR627781ff360See ref.360SSCP8-NA
07C03CR627785GATGGCAAGGTTTTGCAGACTCTCTTCTGGCTGGCTTTTC2851-128596.6*DGGE-CNI-4
08A01CR627918ff210See ref.500SSCP3 E-NM
08A03CR627920GCTGCAATGTGAAGTGGTGTTGGGAGGAAGTGGAAGAATG4541-145494.1*SSCP12 E-NI
08B04CR627933ff327See ref.327SSCP9-NM
08C05CR627943AAACTCCTGTCATCCGCAACCCCGGATTTGGTTAGGAAGT2132-221395.5*SSCP2-NI
08C11CR627947ff31631694.4SSCP2-1
08D11CR627958GGTACTTCATTCCCACAGCAAGGCTCCAATGTTGCTCCTTA3438-870088.4*SSCP11-3
08G04CR627986ff393See ref.1000SSCP11-NA
Cons 13CR627506CGGCGAGGTACACAAATCTAAAACGGCACCGTAAGGTTCTT3011-230189.5-93.1SSCP1-6
Cons 14CR627508TTGTGGTAACCAGTTCGACTCTAGTTGTTGGGCGTGCTTT2431-11200SSCP5-4
Cons 19CR627517GAAGCACAACAATGTTATCCCTAACCGGGCAGGTACAATAGGA1781-230081.3SSCP-Q DGGE-C9-2/4
Cons 21CR627523GAATCGCCAAGTGAAACCATGGGGGTTCTTCAGAACGATA3331-155089.3SSCP2-1
Cons 30CR627541GGGGATTCATTGCCACTTCTCATACTTTGCATCGCCAACA4241-11400Q 1500C93.1SSCP4-2
Cons 33CR627568GAGAAAACCACATAGAGATCAGATGGCTCGGTAGCGAGAAAGAAG1533-3200Q 250C95.3SSCP12 E-12
Cons 38CR627606AAGCTTCCCATGTTTGGATGCTGCACTTGACGCTTGTTGT1235-512391.7DGGE2-1 E
Cons 41CR627646CAAATCTGATCCCGCAAAATGCCATTGACACAAAGAACCA4431-150090.7*SSCPNI-1
Cons 46CR627952GCCGAGGTACAAAAATCCATACCATGAGAGCCAAGTGGAA215NA-2800CSSCPNA-9
Cons 48CR627721TCAACACCAACACCAACACCCAGGTACCAGCAAGGTCACA1914-4191Q 400CDGGE-Q6-NI
Cons 58CR627732CCAATTCTCTTAGTGGCAAGGGCTTTGGGATGATGTTTTGG2551-150092.7SSCP5-4
Cons 61CR627776ATTTCGAAGCTCGACTGCATGTCCATTGCAGATGGCTTTT2601-NA1600Q95.7*SSCP6-NA
Cons 68CR627777GAAGTTGCTTCTGGGGATCAGGCTCGTACGTGAACTCCTC2445-NA500Q92.9*SSCP1-NA
Cons 72CR627907AGGAGCCCTCCTTTAGCAGTCCCGCAGTTAAAAAGGCATA3121-11000Q 800C90.9*SSCP10-NI
Cons 74CR627801AACCTTGCTAAGGCCCTCTCCATCAGAAGGTCCCAGTGCT1373-313786.7SSCP9-9
Cons 75CR627924GGCAGGTACCTCCATGGTTATCAATGCTGGCTTCTTTGTG2576-660088*SSCPNI-8
Cons 86CR627976CCAGATATCAGGAAAACCAAGCCAAGCATGAAGCACCACTCAAC2703-NA600SSCP8-NM
Cons 90CR628018ATAGCACCGCACTTGCACTTTGCAAACTTAACCCAATCACC1883-1300Q 1200CSSCP2-7
Cons 104CR627823GCTTGCAGGGTGTTAGTGTGTCCTAATACAACATTGTCTTCCTCA2505-525095.4SSCP3-8
Cons 105CR627826GCTGCACGAGTGTTCTCTGTGAATGGCGTGTCAAACATTG1851-160095.4SSCP12-12
Cons 106CR627828GGTGGGGTGAGCAGTAGAAAGGATGTTGGTGTTGCTGTTG3261-132691.2*SSCPNI-1
Cons 107CR627830TCTGGTGGTGAAATCATGGAGAAGTGAACACCACCCGTTT2721-190092.6SSCP11-3
Cons 109CR627834GGTCACAGGTGCAGTTGGATCTGCGGAACTGGCTGTAAGT1941-11200100*SSCP7-5
Cons 110CR627835AGGGGTGATATTGCACTTGGGCAGTGACCTTGTGTAAGATGG2196-621992.6SSCP9-9
Cons 111CR627837TTCTTTTCGCCTCATTCCTCGCTGGCGTTTAAAATTATTTGC2191-3219Q 600C89.5*SSCP12-NI
Cons 112CR627839ATGGCTCGTACCAAGCAAACGGGCAGGTACTTTCGGATCT1711-117193.4*SSCP5-4
Cons 126CR628009ACCCTTACCCTGCGACTTCTTGCTCAAGAGGCTGTGAAGA2381-140094.7SSCP7-5
Cons 127CR628014CAAACCTCCCATTCCACATCCCCAAGGTCAGCACAAACTT2896-628994.3SSCP6-11
Cons 128CR628019GCAGTGCTCTCCACAAACCTGGTGGCAAGCACCAACTAAT1203-3120SSCP6-NI
Cons 129CR628021TCCTCCTTCCAGCACCTCTATTATGGCAGGCTTGGGTTAG2101-150079.6SSCP9 E-9
Cons 130CR628241CCATTGAGCTCCTTCTCAGCCTTCAACAGGTGCAGCAAAG1906-619091.9*SSCP2-NI
Cons 135CR628167TGCCTTCTTACCAGCTCCTCGAAAGAGGGAGACCACGTCA1151-1200100*SSCPNI-1
  • a STSs 08A01, 07B10, 08B04, Cons 86, and 08G04 have not been sequenced.

  • b The expected sizes were based on the knowledge of the EST sequence and primer design. The observed sizes were approximate because they were based on an electrophoresis on an agarose gel. The unmapped amplified ESTs were either noninformative or mapping methods (SSCP or DGGE) have not been successfully optimized.

  • c The protocol PCR1 corresponded to the one described in materials and methods: 10 touchdown cycles from 58° to 53°, followed by 25 cycles at 53°. Protocol 2: 55°–50°/25 cycles at 50°. Protocol 3: 55°–50°/30 cycles at 50°. Protocol 4: 65°–60°/30 cycles at 60°. Protocol 5: 58°–53°/30 cycles at 53°. Protocol 6: 60°–55°/30 cycles at 55°. Protocol 7: 68°–63°/25 cycles at 63°. Protocol 8: 67°–62°/30 cycles at 62°. NA, nonamplified. Ref., reference listed in columns 3 and 4.

  • d Except for 01E07 and Cons 129, all STS sequences matched the same gene in both species using a BLASTX procedure. If STS was mapped or sequence was available for only one species, alignment was done with the original oak EST (*). In five cases, sequence reaction did not work (—).

  • e We used a LOD threshold ≥6.0 to map STSs except for those marked with E, for which 4.0 < LOD score < 6.0. NI, noninformative; NM, nonmapped.

  • f J. Derory, P. Leger, V. Garcia, J. Schaeffer, M. T. Hauser, F. Salin, C. Luschnig, C. Plomion, J. Glössl and A. Kremer (unpublished results).