TABLE 2

Single-stranded DNA primers used for PCR and Sequencing

Primer5′ to 3′ sequencePosition in spe-10 sequence
AC3-fwd3CACGGTATTTTTTTACTCCTGCGGNA; sense primer left of spe-10
AC3-rev3GCAAGCTGAAAACTTTGTTGGTGTAIntron 3 and exon 4; antisense primer
AC3-fwd4ACCAACAAAGTTTTCAGCTTGCIntron 3 and exon 4; sense primer
AC3-rev4AAATTTAGGGGTGGCCGTANA; antisense primer right of spe-10
AC3-rev6CGTGAACAACGTTTTTGCAAGACTCCACATExon 2; antisense primer
AC3-rev7CCCACTTGATCACATTCAGCGACGACTACTExon 3; antisense primer
AC3-fwd10CTCTGGTGGTCACTTTATATGTACGTGACAGTGACExon 2 and 3 junction; sense primer
AC3-fwd11CACCTGAACAGCTTGCACAACAAAATACTATTTTGExon 3 and 4 junction; sense primer
Cla-fwdGGTATTCAAAGATTTACGTAGCAGTGCExon 2; sense primer
Cla-revCAGTTGTCTCGTTCAATGAGATCAAExon 4; antisense primer
  • NA, not applicable.