TABLE 2

Primer sequences

NameSequence
SlX1 + 11AAGCTCACAATGCTGATCTTCACTG
SlX1-7ACTTGCAACGACTTCACTTTGAG
SlXY1 + 3AGGCTCGTTCTCCCTTTGTG
SlXY1-10TCCAGCAGAGCTTGAACAGTC
DD44_3FCTTTGCTACCAAGGCTCCTG
DD44XY + 1ATGTCAATGGCGAACCGCAT
DD44XYR2.1CTCCATCTGTCTTGCCCTGG
c2B12 + 1GTCCGTTGCAAAGGCTCTTC
c2B12-2ACTCACGGACAGGTCTTTTGC
c2B12 + 6GARATNAGYCCNATGTGGCCNG
c2B12-4CAAAAGTAGATTGACGGAAACAGC
c2B12 + 9GTAATCATTTTGCCATCATCTCTT
SlX4 + 11GTGGCCTGGGCGTCTATGTG
SlX4-3AATTACCGAAGACAGTAAAGCGTC
SlXY4 + 12TCCAGAGGAACAAATACAAACAG
SlXY4-8CTGAATGGGTAAATACTCCGA