TABLE 2

PCR and sequencing primers for AMT4

PrimerSequence (5′–3′)Position in DNAaPosition in RNAa
−1577FATGCAGCCATGGTGGGAGTGC−1577–−1557
ATGFATGGCGGACGAGATGGATCC   1–20   1–20
ATGRTCATGGGATCCATCTCGTCC  25–6  25–6
500FTTGCTCAGCTGCAGATCAAACG 477–498
500RTCGTTTGATCTGCAGCTGAGC 499–479
TILL1FAACAACCCCAACGGCTTTGTG 700–720
TILL1RAAAGCCGTTGGGGTTGTTGC 717–698 360–341
TILL2FCTCAACTTCAACGCCTACCTC1089–1109 505–525
TILL2RTGAGGTAGGCGTTGAAGTTGAGG1110–1088 526–504
928FTGCCTGTCCTGCCTGCTCACC1790–1810 928–948
1195RAGCAGGCCGGCAAAGAACACG2058–20381196–1176
Short1FATCGGCATCATCTCCATCTTCG2392–24131303–1324
Short1RAGATGGAGATGATGCCGATCACC2410–2388
Short2FATTGGACTTTCTGCTCATGG3484–35032066–2085
UGA-1RGTGCTTTCCATCTGAGCACC3732–37132314–2295
EndRTTTGGACGGCAGACTGTGCG4009–39902591–2572
  • a Relative to ATG translational start. Positions of the primers are also shown in Figure 6A.