TABLE 1

Names and primers for mapped M. guttatus sequence-tagged site (MgSTS) markers

Marker nameForward primer (5′–3′)Reverse primer (5′–3′)
MgSTS18GGTTGGCCAAGTATCGATTTAGGCAAACCCACATAGCATC
MgSTS19ATTTGCCGTTCCACAATCTCAGTTCCATTCGACCGATACG
MgSTS25AATGGAGATGTGGGCAAGATAATTGCGGGAACAGCATTAG
MgSTS35AAAATCGGGGAGAATTTTGGCACACGTGGCTGGATTACAC
MgSTS38ATGAGCATGGCATCGACATAGTCTCACCGTGTCGGATTTT
MgSTS41GGTAGCGGAATTCATCCTCAGCAGAGCTTTCACCACCTTC
MgSTS43CCGGGAAACGATAGAACAAACAAGGGAGTTCCCTGCAATA
MgSTS54TCAAATTCGATGTGGGATCAAAACCCGACTGCTGCTAATG
MgSTS56GGACTGATGCCAAACCCTAAAATCTGCCTTCCCAAAAGGT
MgSTS87CTTCGACGATGCAGAGAGTGACATAAGCCCTCCTCGTGAA