TABLE 1

PCR primer sequences

First-round PCR primersProtocolaSecond-round PCR primersProtocola
Inverse PCR
Ac10: TGAACTTGGTTGCAAAGGATG
   GCTTGiPCR-2a,
   iPCR-3aAc11: GGGTTCGAAATCGATCGGG
   ATAAAACTiPCR-2a
Ac14: TCCACTCCTCGGCTTTAGGA
   CAAATTGiPCR-2b,
   iPCR-3bAc12: GCAGGAACAATTGAGAAA
   ATCAAAGCGiPCR-2a
Ac18: ACGAAACGGGATCATCCCGAT
   TAAAAACiPCR-2a,
   iPCR-3a,
   iPCR-3cAc15: AGGTATTTTACCGACCGTT
   ACCGACCGiPCR-2b
JGp2: CCGGTTCCCGTCCGATTTCGiPCR-1b,
   iPCR-1cAc16: AATTGAGACAAACATACCTG
   CGAGGAiPCR-2b
JGp3: ACCCGACCGGATCGTATCGGiPCR-2b,
   iPCR-3b,
   iPCR-3cJGp3: ACCCGACCGGATCGTA
   TCGGiPCR-1b, iPCR-1c
TBp35: GTCGGGAAACTAGCTCT
   ACCGiPCR-1a,
   iPCR-1cTBp32: CAAACATACCTGCGAGGA
   TCACiPCR-1b
TBp42: GGCTGTAATTGCAGGAAC
   AATTGiPCR-1aTBp34: ACCTCGGGTTCGAAATC
   GATCGGiPCR-1a, iPCR-1c
TBp43: GAATTTATAATGATGACATG
   TACAACiPCR-1bTBp37: TAATGAAGTGTGCTAGTG
   AATGTGiPCR-1a
Ac700 fragmentProtocolbAc900 fragmentProtocolb
Probe synthesis and PCR verification
Ac700 (5′): TTTCCCATCCTACTTTCA
   TCCCTGPCR verificationAc900 (3′): CGTTACCGACCGTTTT
   CATCCCTAPCR verification,
   probe synthesis
TBp38: AAGCTTCATTTGTCAATAAT
   CATGAc700 probeTBp40: GAATTCAACCTATTTGAT
   GTTGAGAc900 probe
TBp39: CATCTAGTTGAGACATCATA
   TGAGAc700 probeTBp41: CAACAATCTCCGAACCAA
   GACGAc900 probe
  • a Ac-specific primers for iPCR-1, iPCR-2, and iPCR-3 are listed; primers used to amplify sequences flanking (a) 5′ (BamHI) end of Ac of EcoRI-digested fragments, (b) 3′ end of Ac of EcoRI-digested fragments, or (c) both ends of Ac of PstI-digested fragments are shown.

  • b Ac-specific primers for use in PCR verification protocol and for probe synthesis for use in DNA blot analysis.