TABLE 3

Repair junctions from lig4 spn-A mutants

Left end
 acccagacCATGATGAAATAACATA
 tgggtctgRight end
 acccagac
 ATACAATAAAGTAGTACtgggtctg
Junctions with microhomologya
acccagacCATGATGAAATAACATGTTATTTCATCATGacccagac
acccagacCATGATGAcccagac
acccagacCATGATGAAATAACATATGTTATTTCATCATGacccagac
acccagacCATGATGAAATAACATTATTTCATCATGacccagac
acccagacCATGATGAAATATTTCATCATGacccagac
acccagacCATGATGAAATAACATCATCATGacccagac
acccagacCATGAcccagac
acccagacCATCATGacccagac
GACCCAGAC
(7-nt deletion)TGA(43-nt deletion)
acccagacCATGATGAAATAACATA(56 nt)…acccagac
acccagacCATGATGAAATAACATA(173 nt) acccagac
Junctions with T-nucleotides
acccagacCATGATGAAATAACATA[taatataattatgttatg]TTATGTTATTTCATCATGacccagac
acccagacCATGATGAAATAACATA[cataacatacataacatacataacataac]ATGTTATTTCATCATGacccagac
acccagacCATGATGAAATAACATA[tgttattatgttattatgttattattataataac]ATGTTATTTCATCATGacccagac
acccagacCATGATGAAATAACAT[ttataa]TATGTTATTTCATCATGacccagac
acccagacCATGATGAAATAACATA[tttca]TATTTCATCATGacccagac
acccagacCATGATGAAATAACAT[ca]TTATTTCATCATGacccagac
acccagacCATGATGAAATAA[taaataata]ATGTTATTTCATCATGacccagac
accc[gtagcacacctttacctatgctagactatagactat
   accataccataccatgccataccatactata
   ccataccataccatatcatacccctg]CATCATGacccagac
acccagacCATGATGAAATAACAT[taacataac]ATAC-(82 nt)-acccagac
acccagacCATGATGAAATAACA[ataaataacaataacaataataacaataaat]AACT-(204 nt)-acccagac
  • a The first sequence was observed eight times, the second four times, and the third twice. All other sequences were unique.

  • See Table 2 legend for explanation.