TABLE 1

Markers used in the high-resolution fine mapping of sun

Marker nameSizeOriginCopy
 numberPrimersUse
TG5761.3 kbGenomic clone, tomato
   map (Pillen et al. 1996)1TG576-R1: AAGGTCAAATGGCAGTCACC
 TG576-F2: CCGAAACGGGGAAAAATAATCAPS marker in
   EPN/SNP in EPM
CT521.2 kbcDNA clone, tomato map
   (Pillen et al. 1996)1CT52-F2: GGCAAAATCAAGATCCAAGC
 CT52-R4: GGTTTGTGGGAGAGATGAGGCAPS marker in
   EPN/RFLP
   marker in EPM
GP1210.95 kbGenomic clone potato map
   (Gebhardt et al. 1991)1RFLP marker in EPM
cLPT4D211.2 kbTomato EST1RFLP marker in EPM
Le33O1-R306 bpPCR product from Le33O1,
   M13R end133R1: CATGAGAGGAGACCCCTTTTT
 33R2: GGGTTGCATCTCATTTGTCARFLP and SNP in
   EPM
Le33O1-F278 bpPCR product from Le33O1,
   M13F endMultiple
 copy33F1: CAAATCTCACATCGAAAAGACA
 33F3: TTGTATATCAAATCAGATGGCAAAASNP and indel in
   EPM
Le37F23-F397 bpPCR product from
   Le37F23, M13F end137F1: ACAAGGTGCCAACAACACTG
 37F2: GCCAGAACGAAGCAGCTTTARFLP marker in EPN
Le37F23-R287 bpPCR product from
   Le37F23, M13R end2–337R3: TTTCTCCTTGCCAAGTCTGG
 37R4: TGGTATGGCTGCCCTAAGACIndel in EPM
Le76E24-U2.9 kbNsiI-digested subclone of
   Le76E24, large fragment1RFLP marker in EPM
Le76E24-L0.6 kbNsiI-digested subclone of
   Le76E24, small fragment1RFLP marker in EPM
Le124E22-U1.6 kbNsiI-digested subclone of
   Le124E22, large
   fragment
   Identical to Le278H2-U1RFLP marker in EPM
   and EPN
Le236C15-U1.2 kbNsiI-digested subclone of
   Le236C15, large frag-
   ment. Identical to
   Le278H2-L, Le27J5-L1RFLP marker in EPM
Le236C15-UU400 bpPCR product from
   Le236C15, M13R end1236R1: TCGACGTGGTGAAGAGTCAA
 236R2: TGTTTGGGTTGTTTGGTGAASNP in EPM
Le236C15-L0.6 kbNsiI-digested subclone of
   Le236C15, small
   fragment1RFLP marker in EPN
Lp12L2-F306 bpPCR product from Lp12L2,
   M13F end112F1: ACCGATTCCTCAAGTTCAGC
 12F2: TTCCAAGACCAAGAGCATCCRFLP marker in EPM
Lp61O2-F297 bpPCR product from Lp61O2,
   M13F end161F1: CATCCTCGTTCGGCTGTAATRFLP marker in EPM
61F2: ACCCCATCTTCACTGACTCC
Lp61O2-R298 bpPCR product from Lp61O2,
   M13R endMultiple
 copy61R1: TGCATCAACTAGCTGACCCTTA
 61R2: TCGTCATATTGCGCTTATCGDominant marker in
   EPM
Lp81B9-F290 bpPCR product from Lp81B9,
   M13F endSmear81F1: GCTTGCTATTGGGACCTTCA
 81F2: CCCATAACCTCCTCGTTTGASNP in EPM, temper-
   ature for dHPLC
   is 55°
Lp81B9-FF473 bpPCR product from Lp81B9,
   probe for library screen.
   Amplifies only L. pennellii
   allele281R3: TTTCCAGGGGCATTTATTGA
 81R4: AAGCCATGATTAATACACAAAAAGCRFLP marker in EPM
Lp103E7-F1 kbNsiI-digested subclone of
   Lp103E7, HIII fragmentRFLP marker in EPM
Lp103E7-R275 bpPCR product from
   Lp103E7, M13R end2103R1: GGGGAAGGTCCATCACAGTA
 103R2: TTCCTAAGGTTCATTAATCCAAAARFLP marker and
   indel in EPM
Lp104D16-F287 bpPCR product from
   Lp104D16, M13F end1104F1: GCTTCATCGAAATGTGAGATGT
 104F3: CAAAATTCCAACATAAATGACGAARFLP marker in EPM
TGR1162 bpSubtelomeric repeat
   (Schweizer et al. 1988)Multiple
 copyEP65: CCAACCGTATGCATAGACAA
 EP66: CGTTTGGAAGGTCAAACGAGNA
  • CAPS, cleaved amplified polymorphic sequence; EPM, esculentum-pimpinellifolium population; EPN, esculentum-pennellii population.