TABLE 1

Polymorphic sites in OsC1 of 19 haplotypes detected in 43 wild and cultivated rice strains

Positiona
HaplotypeType of
 mutation:1111111111
 1123344444555555555555566677777788999990111111222
 72828823789112223355678903724668934136776127889255
 02088982112690484938518390524296564838033426361235
 rriirsiiiiii-iiiiiiiiiiiiiiirrs---srrrs-ssrrsrrrrsStrainb
SA1GCTGTCTGAGGCGGCTGGGTACTGTGGTCTCabcCAAAGdGCTCAACCTGJp (A58, T65)
SA2…T…Jp (A56, A18)
SA3…C…Jp (A38, A83, A136,
 544), Jv (226, 647),
 In (I33)
SA4…C.GA-…Jp (A55, A108, A5)
SA5…-…C…Jp (734)
SA6…-..C…In (IR36, 868, 108,
 414, 719, ARC6622,
 Acc35618)
SA7…C…A…G…TC…T…In (160, 706, N303,
 C6172)
SA8.G…A…C…In (I47)
SA9.G…C…In (I32, I45),
 Ra (W2012)
RU1…C…T…Rp (W1944)
RU2…A…C…AARp (W1943)
RU3…C…A…G…TC…Ra (W107),
 Rin (W1819)
RU4…C…A…G…C…TC…Rp (W120)
RU5…C.G..T…G…TC…Ra (W1865)
RU6…AA…C…G…C…T…Rp (W1294)
RU7…AAT.-.C…TG…C…T…Rp (W593)
RU8…AT…AA…TC…TG…CT…T…Ra (W2002)
AFA.C…A.GG.GA.T…T…C…-A.C.GC…W025, W1468, W1647
GLU…A..CT.AGG.GAC..C…--C…G…A..W1187
Embedded ImageEmbedded Image
Embedded ImageEmbedded Image
  • a Numbering is relative to the A in the ATG start codon taken as +1. Positions 70 and 122 are present in R2 and positions 388, 389, 744, 762, 769, 786, and 795 are in R3.

  • b Jp, Jv, In indicate Japonica, Javanica, and Indica types of O. sativa, respectively. Ra, Rin, and Rp indicate annual, intermediate, and perennial forms of O. rufipogon, respectively.

  • Bracketed areas show the minimum number of recombination events (positions 492–516, 516–528, 528–553 and 553–565). The types of mutations are indicated by letters: i, intron; s, synonymous; r, replacement; -, indel). Dots indicate nucleotides or indel sequences identical to the first sequence. Indels: a, TC; b, ACTGGAACAG; c, ACCGCCGC (9-bp deletion in GLU, position 836–844); d, AGCGGCGGCGGCGGCGGCGACGACGACCACCGTGTGGGCG (34-bp deletion in SA4, 6-bp deletion in AF).