TABLE 1

Summary information on the six SSRs used to identify LGs IV, V, and XI including length in base pairs and optimum annealing temperature

SSRRepeatLGSequenceLength (bp)Annealing
 temperature
STM5140(AAT)7IVF: GCTATTGTTGCAGATAATACG180–19045°
(estp104b1)R: GCCATGCACTAATCTTTGA
STM3160(AG)25IVF: ACTCAGAACACCGAATGG105–12754°
R: CTCCACTACTGGTCAAATCC
STM3179(AT)10VF: ACCATAACCATCATCGTCTAC168–18554°
R: GATAGTGATTGGTGGTGATTC
STM5148(GAA)17VF: TCTTCTTGATGACAGCTTCG380–44055°
R: ACCTCAGATAGTTGCCATGTCA
STM5109(TA)9XIF: ACAGCTTTACTCTGCTCAACAA208–21257°
(estp2OB8)R: TGACGGCGTTATTACAAAC
STM5130(CGG)5XIF: AAAGTACAGCGAAGATGACGAC240–25057°
(estp21B15)R: TTACCTTTGCAACCTTGCC