TABLE 1

Selective gene mapping strategy in Xiphophorus

GeneForward primerReverse primerPolymorphism
 typeRestriction
 endonuclease
APEaggcaagaagacagatgatgggtctagaagtttgggaactcggctgtgPCR/restrictionHaeIII
CDKN2XtaaaccagaacaactaagtggctgtattgctcttcgtccaPCR/sizeNone
ERCC2agaacaacgtagacacgctgcggcagcatccgtctccttPCR/restrictionTaqI
FEN1tagcaagtgggtaaaccaggctaactagatgcacatggaggcatcaatagcaatPCR/restrictionCfoI
FoxO5ctctcaccgatgatctactccagtcgatggaggtgtcaatttgcatggaggatgttcPCR/restrictionAluI
LIG1gggcctgatggtgaagactcttgtgtcgcccacaccgtPCR/restrictionCfoI
NF1gcttgctgtggaacaaccaggtcgcctgccaactgccttPCR/restrictionHinfI
POLBgcatccaccattgccaagtatcctttccagtttgtaagaactcatcgatcttttctgPCR/restrictionAluI
RAB27gcactaaggcagacatcagagggttcagagccaggggccccaPCR/restrictionTaqI
TP53cttcaggtcaggatttcagtcgccccacctccagtcctcttaactctPCR/restrictionBclI
UNGtaggtcaagatccatatcatggtcgatgctgaaagccgtcgaPCR/sizeNone