TABLE 1

Molecular polymorphisms discriminating D. simulans FC and D. mauritiana SYN

Marker nameCytological
 locationTypePrimersPCR TARestriction
 endonuclease
ewg  1A sATAACAGCAACCAGCGGCGG64° AccI
GGGCATCCATCCTCACATTGG
DMU56661  4F mTATTTCGCTAACAAACCGGCNA NA
AACGCGATCACAAACATCAA
DELTEX  6B mACGCAATAAGTTGGCGTANA NA
AATCAGGATAATGCCTAAT
AC004114  8E mTTTTATTCCAGCCATCAGGCNA NA
TGCGGTCCTTTACCATAAGC
v  9F sTGTCCCTATGCAGGAAACGG52° TaqI
TGAACAGATGCTCATCGTGC
DROEXO2 13F mTGCAGGGCACCTTCTCTCCANA NA
GAACGCTTGATTTAGATTTGGG
DMARIADNE 16F mAACACTGTCCCCATCCACATNA NA
TCTGTTCAACTCCTTCGGCT
run 19E sAGTGCATACCGAGAATCCGC53° BsiEI
ATTGATGGCGATTGCGGAGG
DROEXPAND 21C mGTGATCGATCCCGCTGTCNA NA
TCCGGTTTCCAATTAGCTTG
Gpdh 26A sCCCCTGTTCACGGCTATTC60° HinfI
CTGGTGATTTGATCTATGCGG
AC005889 30A mGCGTGGCTGGCATATAGNA NA
TAAGCCCCCTCGTGTAATTG
prd 33C sGATGCAAGGTGAGTGTCTATC52° Tsp509I
GCCATGGGATACACGTAGCT
AC002474 38D mGATGCTGTCCTTCGGACTTCNA NA
AACAACAAAGCCCATTCTGC
DucC 42C sAAGAGGCCACAGAGCAGC65° AluI
TTACCCGAGAAGATGATGGC
eve 46C sTTGTGGACCTCTTGGCCACC63° DraI
AACTCCTTCTCCAAGCGACC
Su(z) 49E idGTTACAACTGGAGCCGGGTA62° NA
CACAATTGGATTGGGTTTCC
sli 52D sTTACCAGCTTTAAGGGCTGC50° AciI
CATTTGTTCTCCAGGCAAGG
AC004365 58A mGCTTTATCAATGCAGCCTCCNA NA
GGCCCCAATATGTCCTCGCC
twi 59C sTCCCTGCAGCAGATCATCCC63° HinfI
ATCACTCGAGCTGAGCATGC
ve 62A sGAGAACCCAACGCAGAATGT52° PstI
ATATCCTCCGACTCCGGAAG
h 66D sACTCAAGACTCTGATTCTGG TGTCTTCTCCAGAATGTCGG55° DraI
CycA 68E sATTTCGCCGTGCTCAATG57° HinfI
ACGTCATGGTTCTCTTTGTCG
Eip71CD 71D sCCTGTATGGAGCCACCCG55° BsmAI
GGGGCTGAGATTTAGCGATG
rdgC 77B idCAAAGACATCGACTCAGCTACG62° NA
CGAACTCTCCACGATGCC
5-HT2 82C sTGACGATTCCCCTCCTCC52° HinfI
CGCCCACTGATAGGAATTTG
Antp 84B sACGGACGTTGGAGTTCCCGA60° MseI
ACATGCCCATGTTGTGATGG
DROHOXNK4 93D mCTGAAGTTGAAGTCCGAGCCNA NA
TACATGTGCTGCATCTGTTGC
DROTRXIII3 88B mGACCGTTTGTTTGCCTTGATNA NA
TGCCTGTACAAGTCTGACCG
DMTF125 95C mCTCGAGCGGGCCATACAAGANA NA
TGATTGAAGAGGCCACTCAA
Ald 97A sATGGGCCCTCACCTTCTC52° XmnI
GTGGTCATCCACATGCAAAG
DROROUGH 97D mAAGCAATGCCACACAATGAGNA NA
CGGTTATTTTTTTTCCTTGGC
Efld2100E sGACTGGTCTCCTCAAGCCAG62° SfcI
AGCCTCGTGGTGCATCTC
  • Cytological locations are given on the basis of D. melanogaster cytology (FlyBase Consortium 2003). The marker type is m, microsatellite; s, SNP; id, insertion/deletion. The PCR protocol for all microsatellites is 1 cycle 95°, 5 min; 5 cycles 95°, 45 sec, 68°, 5 min, 72°, 1 min, decreasing the TA each cycle by 2°; 4 cycles 95°, 45 sec, 58°, 2 min, 72°, 1 min, decreasing the TA each cycle by 2°; 27 cycles 95°, 45 sec, 50°, 2 min, 72°, 1 min; and 1 cycle 72° 5 min. The PCR protocol for all other markers is 1 cycle 94°, 5 min; 30 cycles 94°, 1 min, TA°, 45 sec, 72° 1 min; 1 cycle 72°, 5 min; where TA is listed. Primers are listed from the 5′ end. Microsatellite markers were run on a 6% polyacrylamide gel and imaged with a LICOR Gene Readir 4200 DNA analyzer. PCR fragments containing SNPs were digested with a restriction endonuclease and then run on a 3% agarose gel and manually genotyped. TA, annealing temperature; NA, not applicable.