TABLE 1

Genes surveyed and primers used for amplification and sequencing

Gene,
contig accession no.,
exon position,
accession no.
for alleles
Primer positionsPrimer (5′ → 3′)Primer name
RhoGAP1A (EG:23E12.2),22,520-22,542atgcagtacaagaaggccatcca12.2A A+
AL031884; GI:3763961,23,990-23,971acttttaactcccaccttaa12.2A A-
22,520-23,530,23,135-23,155gtcatcgcatgtgccaaatac12.2A B+
AY312787-AY31281523,075-23,055aagaattacgcaccatgcgtc12.2A B-
22,941-22,960atgcgcatccggatcaccag12.2A C+
23,607-23,588gcaggttgcatttttgctac12.2A C-
CG3038 (EG:BACR37P7.1),2,278-2,297gccagcccgacaaataggcgP7.1 B+
AE003417; GI:22831400,2,842-2,822ctttgctttaatcaaccattgP7.1 A-
1,877-2,784,1,785-1,804caatatttgtctcttccttcP7.1 A+
AY312642-AY3126702,346-2,327ccaataagtggtacgttagcP7.1 B-
1,886-1,905tcgcaacgcttttatttcagP7.1 1+
cinnamon,13,267-13,288gtgggcttttatccccatagaccin A+
AE003417; GI:22831400,13,815-13,795cttttgggcggatccttggaccin A-
13,319-14,079,13,729-13,750cttttgcctcacgctgttcacccin B+
AY312700-31272814,219-14,200gccagcggcaaagaattaggcin B-
CG3777 (EG:125H10.1),103,879-103,900atgaagagcatcgaggccaaaaH10.1 A+
AE003417; GI:22831400,105,145-105,126ttctaccagtcttgtttgttH10.1 A-
103,879-105,145 complement,104,862-104,842ctcatcctcatcagtacttgcH10.1 C-
AY312671-AY312699103,798-103,917gactattcgatgaatctgctH10.1 C+
pangolin,127,493-127,512ctgttctgtaactcttaaggpan A+
AE003845; GI:28380223,128,376-128,357tcgtgggttagcaccaatagpan B-
127,653-128,742,128,859-128,840gatggctttgggctggcgagpan A-
AY312729-AY312757127,825-127,844gaagatgaggactcggaatcpan B+
127,673-127,692gttatatggaagccctgaacpan 1+
128,213-128,233caccagtagttagcacgagcapan C+
zinc finger homeodomain 2,63,979-63,999caatggtgacctcaggcagtgzfh B+
AE003843; GI:28380216,64,986-64,965ccgacaaggactgcatttcatczfh B-
63,123-66,020,64,640-64,621gaagtcagtaagcgaagaagzfh D-
AY312816-AY312844
Pleiohomeotic,269,264-269,244gacaaaataaaagcggctgacpho A+
AE003846; GI:28380228,268,317-268,338catttccccacatccagtcgagpho A-
268,401-269,170,168,754-268,735atgcacagacccttgaaatgpho B+
AY312758-AY312786269,331-269,312tgaccgaattattcattcagpho 1+
ATP synthase beta,128,795-128,746tcaatgatagatttgctgacATP A-
AE003846; GI:28380228,127,753-127,772tgccggtgtgggcaaaactgATP B+
127,578-128,719 complement,128,214-128,233atgtgcccgctgatgatttgATP C+
AY312613-AY312641128,715-128,696gcagcttcctttgccaggcgATP 1-
127,485-127,504gttggtgccgaaacactaggATP A+
128,283-128,264acagtggtggcatccaaatgATP B-
  • The first four genes are on the X and the second four genes are on the fourth chromosome (see Figure 1).