TABLE 1

PCR primers used to amplify the seven loci

LociPrimer sequences (5′-3′)PCR conditionsa
Acl5AGAAGCAGTGGCAACAAATGG52°, 35 cycles
GTTAGAGGAGGAGTTACAAGCA
Chi1AAAGGCGAATGTGACGGAAAT51°, 35 cycles
CTGGATGATTTGCGGTGTCT
FerrTCTGCGGCTGTAGTTCCAGT58°, 35 cycles
ATAGGCGACGCAGGTCAAAA
GapCTTTGGCATTGTTGAAGGTCT55°, 35 cycles
CAAATCTATGACTCGTGAAC
HemACTTCGGCAGCATCTCTTCAT55°, 35 cycles
AACCTTAGCCCTGATTTTCT
LcybCAGTGTGGAAGCCGATTATGG54°, 35 cycles
GCTGTTGCCCATCTGTTGTTG
PatATGTGTTGTCTGGCTTGGTA58°, 35 cycles
GGTGAACAAGAAAGGGAAAT
  • a Annealing temperature and number of PCR cycles are shown.