TABLE 1

Primers used

LocusPrimer nameDescriptionPrimer sequence
S-domain primers
Aly77-forUsed with primer 7R. Specific for the 7-haplotype (the last position
     of the primer spans the single base pair present in 7+ but
    absent in 7-)
5′ taagtccatgggacggcgtag 3′
Aly77+rev7+ haplotype specific; within 9-bp insertion in the 7+ haplotype5′ aagctgttgtacggatccca 3′
Aly8Ap8fWith SLGR, also amplifies Aly10.1, -10.25′ acgggaactctcaaaatatccg 3′
Aly10.110F1With SLGR, also amplifies Aly10.25′ tccatcaagcggcgatttctcga 3′
Kinase domain primers
srk4RExon 3, amplifies 10.1 only
srk5RExon 3, amplifies Aly10.1 only5′ acagcttctaactctatcaatgga 3′
srknasr1Second base pair of exon 4, amplifies only Aly10.1, some Aly13 plus
    unidentified sequences
5′ tcctgcccgtcaggtaaccttc 3′
srknasr3Base pair 157 of exon 5, amplifies some Aly13 sequences5′ ccatcccgaaatccgatatct 3′
srknasr4Last base pair of intron 3 (2 bp before start of srknasr1), amplifies
    Aly10.2 and Aly8 sequences
5′ tgcccgtcaggtaaccttccc 3′
  • Other primers mentioned in the text are described in Charlesworth et al. (2000).