Primers used
| Locus | Primer name | Description | Primer sequence |
|---|---|---|---|
| S-domain primers | |||
| Aly7 | 7-for | Used with primer 7R. Specific for the 7-haplotype (the last position of the primer spans the single base pair present in 7+ but absent in 7-) | 5′ taagtccatgggacggcgtag 3′ |
| Aly7 | 7+rev | 7+ haplotype specific; within 9-bp insertion in the 7+ haplotype | 5′ aagctgttgtacggatccca 3′ |
| Aly8 | Ap8f | With SLGR, also amplifies Aly10.1, -10.2 | 5′ acgggaactctcaaaatatccg 3′ |
| Aly10.1 | 10F1 | With SLGR, also amplifies Aly10.2 | 5′ tccatcaagcggcgatttctcga 3′ |
| Kinase domain primers | |||
| srk4R | Exon 3, amplifies 10.1 only | ||
| srk5R | Exon 3, amplifies Aly10.1 only | 5′ acagcttctaactctatcaatgga 3′ | |
| srknasr1 | Second base pair of exon 4, amplifies only Aly10.1, some Aly13 plus unidentified sequences | 5′ tcctgcccgtcaggtaaccttc 3′ | |
| srknasr3 | Base pair 157 of exon 5, amplifies some Aly13 sequences | 5′ ccatcccgaaatccgatatct 3′ | |
| srknasr4 | Last base pair of intron 3 (2 bp before start of srknasr1), amplifies Aly10.2 and Aly8 sequences | 5′ tgcccgtcaggtaaccttccc 3′ | |
Other primers mentioned in the text are described in Charlesworth et al. (2000).