TABLE 1

Oligonucleotides used in this study

Oligo nameDNA sequence (5′-3′)
TPR D1-1 UPTCTTGCTTTTTGCCCCTTCTT
TPR D1-2ATTGACCCGGGGATATGGGACAATGGATTCGTTATG
TPR D2-1 UPATCCAGTCGGTTTCTCTTCAA
TPR D2-2TTCCCGGGGCTTTGGATACGATACATTGAT
TPR D3-1 UPGAATGAACTATCTACTAATAATGC
TPR D3-2CACCCGGGGACAAGTTATGGTACAAGTA
TPR D5-1 UPAACCCCTGGCTCCAAGGAGCA
TPR D5-2CACCCGGGATGCAGACATGGCTAAAGTGGGTG
TPR D6-1 UPTTGCGGGTGAGCCATGACGTA
TPR D6-2CTCCCGGGCAAAATTTACAGATTTGGTCTGAT
TPR D7-1UP ATTTTGGAGGTTAGCTACTGT
TPR D7-2CACCCGGGATTGCTATAGAAAAATGGCCCTCC
TPR D8-1 UPAGCAATTTGATAAAGAGCACT
TPR D8-2AACCCGGGAGGAAAATGGAGTATGAAACAATA
TPR D10-1 UPTTTTGATAGTTCTTTTGGTCG
TPR D10-2AGCCCGGGTTAATTGACGACATCATCCCTCAT
TPR DCTD-1 UPGTCTTCATCCACATTTTCGCT
TPR DCTD-2AACCCGGGGAATTCGTGGATTACATTTTTCCT
AB1-1GGGGGAGAGGATCGACTAATATTGATATA
AB1-2ATCCAGTCGGTTTCTCTTCAAATA
AB2-1GGGATGGGACAATGGATTACTTAT
AB2-2GAACTATCTACTAATAATGC
AB3-1GGGATCCCCCTTTGGATACGATAC
AB3-2TACTCTGGGCAACGTACTAATAGC
TPR Dall-1TCTTGCTTTTTGCCCCTTCTT
TPR Dall-2GACCCGGGGTTTGAAATTACCGATGAGAA
RDS1-1CCCGGGATTCATGTCCCGCCATCAGTTTGAT
RDS1-2CCCGGGATCCAGTAGTTACGACGAATATAG