TABLE 1

PCR primers for tagged replacements at URA3

First PCR from pFA6KanMX4
    Forward
    GCAGGAAACGAAGATAAATC-tag-CGTACG
        CTGCAGGTCGAC
    Reverse
    TTTACTTATAATACAGTTTT-tag-ATCGAT
         GAATTCGAGCTCG
    Tags
    1 ATCTTACAAAATTTGGTTTA
    2 TCTGACATGACTAAGTTCAC
    3 GTCTTAGGTATCGACGGCAT
    4 CGAACATAGTTGCTAATGCT
    5 CATCTGGAAGTGAAATCCAT
Invariant Probe
    GCCATCAAAATGTATGGATGC
Second PCR
    Forward
    TCTTAACCCAACTGCACAGAACAAAAACCTGCAG
         GAAACGAAGATAAATC
    Reverse
    GCTCTAATTTGTGAGTTTAGTATACATGCATTTAC
         TTATAATACAGTTTT