TABLE 3

Primers (5′-3′) used for OLA multiplexing of GHR SNPs

PCR
SNPUPDN
F279YGTGGCTATCAAGTGAAATCATTGACACTGGGTTGATGAAACACTTCACTC
Nt864-33(T-G)GCCTCATCATTCACTGCTTAGGTTTCAACATAAGGCTCTG
Nt933+21(A-G)GCCTCATCATTCACTGCTTAGGTTTCAACATAAGGCTCTG
Nt1095(T-C)TCTTGGGTTGAATTTATTGAACTAGATCGCACATGTCACTGACATGGAA
N528TACATTACACCAGCAGGAAATGTGGTTGGTAAGGCTTTCTGTGGTGATGT
Nt1922(C-T)AGGTCGGGGACAGCAGAACATTCATATTCCCCACCCTCAACTCA
OLA
SNPAS1AS2C
F279YFam-GGGCTAGCATGTACATTATAHex-GGGCTAGCATGTACATTATTP-TTTACTCATATTTTCTAAACAGC
Nt864-33(T-G)Fam-GTCTTTTGAAATGAGATGAGGHex-GTCTTTTGAAATGAGAATGAGTP-AACTTACATCAAAACAAAATTTTG
Nt933+21(A-G)Fam-CAAGGTAATTAATAAAATATCTAAGHex-CAAGGTAATTAATAAAATATCTAAAP-TTGTACATGACACTAATTAAATGT
Nt1095(T-C)Fam-CAGACTTCTGAGCAATGACHex-CAGACTTCTGAGCAATGATP-CATGAAAAATCACTCAATATC
N528TFam-TAACTTCATCGTGGACACHex-TAACTTCATCGTGGACAAP-CGCTTACTTCTGCGAG
Nt1922(C-T)Fam-AGCTTTTCTTTGATTTCCCHex-AGCTTTTCTTTGATTTCCTP-ATGAGCTACCCATTGAAT
  • UP and DN are the primers used for PCR amplification. AS1, AS2, and C are, respectively, the two allele-specific primers as well as the common primer used for the OLA reaction.