TABLE 2

Oligos used in this study

Oligo nameSequence
w1-1TCCCGTCTGCTTGAGTGACA
w1-5CCATCGCGGAGGGCCAGGAG
W1-6TCTCCGGCCTGTAAGAAAGT
w1-8AGCTGTTGAAGGCGTCATCA
w1-18AAACTCGGCTCTGGATTCCT
w1-19CTTCGACATCCCGCCCATGA
w1-22CTGACAGCGGGCCTTGATCT
w1-26CCCTGTGATACCCGACCC
w1-27CCAGTTGCCTAAATGAACCA
w1-33ATGGGAAACACGGCTGGAC
w1-U1CTGCGGTTCATTCTCATTC
al1-1CGCGAGACCTTTGAAGATTT
al1-2GCTTGCCGTCGGAGAACCAG
al2-1CGACTCCGCATTGACCTGAT
al2-2AGACCTCACGGCGAGATTTG
con10-1CGAGAAACAGCGCGAAATTG
con10-2CACCAGTGCCACCGGAAGCC
con6-1TAATGTTTCCGAGGAAGCCA
con6-2GGGTTCTTGTCGCCGTCGTC
vvd-1GGATACAGCAATGCGGAGGT
vvd-2CCGTCGGGTGACTGAAGAAA
L6-117FCAGAAATGGTACCCTGCTGAGG
L6-176RGCGGATGGTCTTGCGG
L6-140TTGAGGCCCAGCCTCGCAAGG
wc1-879FTGCACAAGGCATGGCTACA
wc1-940RGGAAGGTTGTCGCGGGT
wc1-899TCAGTCTCACAGGATGCGGCAAGCA
frq-352FTCGACATCGCAGAGGAGAAA
frq-417RCAACGAAACCCCAGACGAGT
frq-373TACTGGCAGACATGGAACGGCCG
c-ha-61CAGCATCAGCAGCAACAAAAAACCAATCAGCGGATCCCCGGGTTAATTAA
c-ha(R1)CGACGATGTAGTCAATGGGCCGAGTGGTTCGAATTCGAGCTCGTTTAAAC