TABLE 2

Primers used for RT-PCR

PrimerSequence (5′ to 3′)Description
9ACCATTGGTAACGAGCGATTCCACT nt 747–768 sense
10TTCCTATCTTGGTGGCTAGGTCACT nt 1040–1020 antisense
11CTGGAGTTGTCCCAATTCTTGTTGGFP nt 26–49 sense
12GAAAGTAGTGACAAGTGTTGGCTGGFP nt 243–220 antisense
13ATGCTCCCCTCCATCGAGCAACGCAP59 nt 1–23 sense
14CGGTGGTTGAACAGACCTCGGGCAP59 nt 518–497 antisense
15CCAATCGTGCTGGAACGGTATCGCCAP59 nt 852–872 sense
16CTCTGGTCCGGGTACAAACTCCCAP59nt 1229–1208 antisense
  • Primer sequences are designated by nucleotide position as in Table 1.